Báo cáo y học: "Data from necropsy studies and in vitro tissue studies lead to a model for allometric scaling of basal metabolic rate" pot

Báo cáo y học: "Data from necropsy studies and in vitro tissue studies lead to a model for allometric scaling of basal metabolic rate" pot

Báo cáo y học: "Data from necropsy studies and in vitro tissue studies lead to a model for allometric scaling of basal metabolic rate" pot

... Biology and Medical Modelling Open Access Review Data from necropsy studies and in vitro tissue studies lead to a model for allometric scaling of basal metabolic rate Page R Painter* Address: Office ... explained by a multi-compartment model incorporating three factors: 1) scaling of brain tissue and the tissues that form the surface epitheli...

Ngày tải lên: 13/08/2014, 23:20

8 357 0
Báo cáo y học: "Lessons from dynamic cadaver and invasive bone pin studies: do we know how the foot really moves during gait" potx

Báo cáo y học: "Lessons from dynamic cadaver and invasive bone pin studies: do we know how the foot really moves during gait" potx

... accessing and measuring the kinematics of individual anatomical structures in the foot have been taken, (i) static and dynamic cadaver models, and (ii) invasive in- vivo research. Cadaver models offer ... metatarsal 5-cuboid, was smaller in (slow) running than in walking. For the ankle, the range of motion during walking was far greater in the sagittal plane, and slight...

Ngày tải lên: 10/08/2014, 21:23

7 271 0
Báo cáo y học: "PEEP-ZEEP technique: cardiorespiratory repercussions in mechanically ventilated patients submitted to a coronary artery bypass graft surgery" doc

Báo cáo y học: "PEEP-ZEEP technique: cardiorespiratory repercussions in mechanically ventilated patients submitted to a coronary artery bypass graft surgery" doc

... and respiratory mechanics (peak inflation pres- sure (PIP), plateau pressure (Pplateau), inspiratory flow (Vinsp), expiratory flow (Vexp), inspiratory resistance (Rawinsp), expiratory resistance ... cardiovascular postoperative com- plications are related to extracorporeal circulation (ECC) and its inflammatory reaction. It is well known that ECC affects the lungs causing alveolar edema...

Ngày tải lên: 10/08/2014, 09:22

6 427 0
Báo cáo y học: "The top five research priorities in physicianprovided pre-hospital critical care: a consensus report from a " pptx

Báo cáo y học: "The top five research priorities in physicianprovided pre-hospital critical care: a consensus report from a " pptx

... found increased survival in trauma patients and a trend towards increased survival in cardiac arrest, myocardial infarction and respirator y distress [49]. Both reviews foundthatthenumberofarticleswasfewandthatthe quality ... espen.fevang@norskluftambulanse.no 1 Department of Research and Development, Norwegian Air Ambulance Foundation, Drøbak, Norway Full list of author inf...

Ngày tải lên: 13/08/2014, 23:20

8 272 0
Báo cáo y học: "Adult mesenchymal stem cells and cell-based tissue engineering" doc

Báo cáo y học: "Adult mesenchymal stem cells and cell-based tissue engineering" doc

... Kuroyanagi N, Yamaguchi K, Gotoh Y, Irie K, Kano T, Shirakabe K, Muro Y, Shibuya H, Matsumoto K, Nishida E, Hagi- wara M: A novel kinase cascade mediated by mitogen-acti- vated protein kinase kinase ... Intracellular signals initiated by TGF-β ligand binding are principally mediated by the Smad family of proteins, particularly the receptor-activated Smads (2 and 3), the common-media-...

Ngày tải lên: 09/08/2014, 01:21

14 347 0
Báo cáo y học: "Tumor necrosis factor alpha and epidermal growth factor act additively to inhibit matrix gene expression by chondrocyte" pptx

Báo cáo y học: "Tumor necrosis factor alpha and epidermal growth factor act additively to inhibit matrix gene expression by chondrocyte" pptx

... for some inflammatory mediators. Cell survival is essential for ensuring ongoing homeostatic maintenance of cartilage and for bringing about repair to damaged cartilage. Maintaining integrity of the ... involved in regulating the aggrecan and type II collagen genes and in remodeling of the cytoskeleton in response to factors present during inflammation. The MAPK/ER...

Ngày tải lên: 09/08/2014, 06:22

12 388 0
Báo cáo y học: "Interactions between IL-32 and tumor necrosis factor alpha contribute to the exacerbation of immune-inflammatory diseases" ppt

Báo cáo y học: "Interactions between IL-32 and tumor necrosis factor alpha contribute to the exacerbation of immune-inflammatory diseases" ppt

... proinflamma- tory cytokine and is related to several inflammatory diseases such as rheumatoid arthritis (RA) and inflammatory bowel dis- eases (IBDs). RA is a persistent inflammatory arthritis and ... 5'-TGAGGAGCAGCACCCAGAGC-3' Antisense 5'-CCGTAGGACTGGAAAGAGGA-3' Human TNFα Sense 5'-GTCTCCTACCAGACCAAG-3' Antisense 5'-CAAAGTAGACCTGCCCAGACTC-3'...

Ngày tải lên: 09/08/2014, 08:23

13 552 0
Báo cáo y học: "Hypertrophy is induced during the in vitro chondrogenic differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene transfer" pps

Báo cáo y học: "Hypertrophy is induced during the in vitro chondrogenic differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene transfer" pps

... Sense: ACAGATGATGACACTGCCACC Antisense: CATAGTAGAGATATGGAGTGCTGC 55 324 35 Internal control EF1α Sense: AGGTGATTATCCTGAACCATCC Antisense: AAAGGTGGATAGTCTGAGAAGC 54 234 25 rt: primer pairs, that have ... ACGCCGACCAAGGAAAACTC Antisense: GTCCATAAACCACACTATCACCTCG 51 483 35 ALP (rt) Sense: TGGAGCTTCAGAAGCTCAACACCA Antisense: ATCTCGTTGTCTGAGTACCAGTCC 51 454 IHH Sense: GAGGAGTCCCTGCATTATGA Antisens...

Ngày tải lên: 09/08/2014, 14:22

15 830 0
báo cáo hóa học: " Beyond platinum: synthesis, characterization, and in vitro toxicity of Cu(II)-releasing polymer nanoparticles for potential use as a drug delivery vector" ppt

báo cáo hóa học: " Beyond platinum: synthesis, characterization, and in vitro toxicity of Cu(II)-releasing polymer nanoparticles for potential use as a drug delivery vector" ppt

... characterization, and metal binding properties of our Cu-binding particles, as well as preliminary in vitro toxicity in cancer cells Results Synthesis and characterization of Cu-loaded polymeric nanoparticles Carboxylate-function ... this article as: Harris et al.: Beyond platinum: synthesis, characterization, and in vitro toxicity of Cu(II)-releasing polymer nanoparticl...

Ngày tải lên: 21/06/2014, 02:20

10 495 0
Báo cáo y học: " Polysaccharides from the root of Angelica sinensis protect bone marrow and gastrointestinal tissues against the cytotoxicity of cyclophosphamide in mice

Báo cáo y học: " Polysaccharides from the root of Angelica sinensis protect bone marrow and gastrointestinal tissues against the cytotoxicity of cyclophosphamide in mice

... cytotoxic effect via transfer of its alkyl groups to DNA, leading to cell cycle arrest and apoptosis. The major site of alkylation within the DNA is the N7 position of guanine. Alkylation of ... expression of growth factors in gastric tissues in response to the damage by CY and protection by AP. 2. Materials and Methods Chemicals and Reagents All chemicals...

Ngày tải lên: 02/11/2012, 10:19

6 655 0
w