Báo cáo y học: "The quantitation of buffering action I A formal & general approach" pdf
Báo cáo y học: "The quantitation of buffering action I. A formal & general approach" pdf
... etc.); ii) a scale that is universal,allowing for adequate quantitation of buffering behaviorin all its manifestations (i. e., irrespective of its particularphysical dimension, and including moderation, ... capable of visualizing buffered systemsand their behavior in an exact yet intuitive way.Conclusion: These two measures of buffering action can be generalized easily to any arbitraryquantity ... physiologicalparameters in living organisms. This article is concernedwith the definition of an appropriate scientific unit, orscale, for the quantitation of buffering action – a quantitythat...
- 17
- 304
- 0
Báo cáo y học: "The quantitation of buffering action II. Applications of the formal & general approach" ppsx
... identification of a reference state may as well beimpossible as a matter of principle, indicating that rigor-ous quantitation of buffering strength in this case is inher-ently impossible and ... "equipartitioning point".Comparison with other descriptions of H+ -buffering by weak acidsAnalysis of H+ buffering by weak acids by means of the buffering coefficient b and buffering ... citation purposes)Mathematical model of free and bound H+ ion concentrations in a solution of a weak acidTo obtain an explicit quantitative description of buffering by weak acids, we first...
- 15
- 233
- 0
Báo cáo y học: "The discovery of potential acetylcholinesterase inhibitors: A combination of pharmacophore modeling, virtual screening, and molecular docking studies" pptx
... Bolognesi ML, Banzi R, Bartolini M, Cavalli A, Tarozzi A, Andrisano V,Minarini A, Rosini M, Tumiatti V, Bergamini C: Novel class of quinone-bearing polyamines as multi-target-directed ligands ... Tumiatti V, Milelli A, Minarini A, Rosini M, Bolognesi ML, Micco M,Andrisano V, Bartolini M, Mancini F, Recanatini M: Structure-ActivityRelationships of Acetylcholinesterase Noncovalent Inhibitors ... Piazzi L, Bisi A, Gobbi S, Bartolini M, Andrisano V,Morroni F, Tarozzi A, Monti JP: Benzofuran-Based Hybrid Compounds forthe Inhibition of Cholinesterase Activity, β Amyloid Aggregation, and...
- 13
- 389
- 0
Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc
... expiratory volume in one secondFVC forced vital capacityIgE immunoglobulin EISAAC II International Study of Asthma and Allergy inChildhoodLD linkage disequilibriumMAS Multicentre Allergy StudyMALDI-TOF ... Ludwig Maximilian's University Munich, Germany, 2Department of Epidemiology, University of Ulm, Germany, 3University Children's Hospital Dresden, Germany, 4Department of Pediatric ... of asthma may havevaried between studies. As ADAM33 may specificallyaffect remodeling of the lungs, the impact of genetic vari-ations in ADAM33 could be variable in different forms of asthma....
- 12
- 355
- 0
Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt
... for biochemical analysisand histologic evaluation.Radiographic analysis of disc heightRadiographs were taken using a digital radiography sys-tem (resolution 71 μm; NAOMI, Nagano, Japan) afteradministration ... performed data acquisition and statisticalanalysis. PJR participated in the design of the study and interpretation of thedata, and revised the manuscript. JA made substantial contributions to ... understanding of itsFigure 4 ChangesinDNA,proteoglycan(sulfatedglycosaminoglycan) and hyaluronic acid content. Changes inDNA, proteoglycan (sulfated glycosaminoglycan (GAG)) andhyaluronic acid...
- 9
- 402
- 0
Báo cáo y học: "The effectiveness of hand-disinfection by a flow water system using electrolytic products of sodium chloride, compared with a conventional method using alcoholic solution in an" ppt
... the dis-infection of hands is a most important procedure forpreventing nosocomial infection. In any intensive careunits (ICUs), the disinfection of hands is particularlyimportant, because ... patient in ICUs are seriously illand with immunologically compromised conditions suchas post-organ transplantation, severe infection andimmunodeficiency syndrome [2,5]. Increased chances of contact ... the system as used by themedical staff in the ICU and compared its antisepticeffects with those of a conventional hand-disinfectionmethod: application of alcohol lotion after hand-washingwith...
- 2
- 450
- 0
Báo cáo y học: "The outcome of extubation failure in a community hospital intensive care unit: a cohort study" pot
... University of Pennsylvania, Philadelphia, Pennsylvania, USA4Medical Director, Medical Intensive Care Unit and Respriatory Care, Hospital of the University of Pennsylvania, Assistant Professor of Medicine, ... aspiration pneumonitis, lobar collapse, asthma exacerbation, noncardiogenic pulmonary edemaCardiac Congestive heart failure, pericarditis, primary cardiomyopathy, acute myocardial infarction, bacterial ... Fuchs41Medical Resident, Hospital of the University of Pennsylvania, Philadelphia, Pennsylvania, USA2Medical Director, Medical Intensive Care Unit, Division of Pulmonory, and Critical Care, St Agnes...
- 6
- 328
- 0
Báo cáo y học: "The University of Tokushima, 3-15-18 Kuramoto-cho, Tokushima" pdf
... evidence.GATAACAATTTTGGTATTTTTTAGGGGTAGGTATGTCGTAGATTTTACATGGAGAACGCGGCAAAAAGCGACGTTCAAGTTCTGTGTCATAA GGTATGTCGTAGATTTTACATGGAGAACGCGGCAAAAAGCGACGTTCAAGTTCTGTGTCATAA TCTGTGTCATAA ATTCTATTTGAATAAGGGGTAGGTATGTCGTAGATTTTACATGGAGAACGCGGCAAAAAGCGACGTTCAAGTTCTGTGTCATAA ATGGAGAACGCGGCAAAAAGCGACGTTCAAGTTCTGTGTCATAA ... ATGGAGAACGCGGCAAAAAGCGACGTTCAAGTTCTGTGTCATAA GGTATGTCGTAGATTTTACATGGAGAACGCGGCAAAAAGCGACGTTCAAGTTCTGTGTCATAA GGGTAGGTATGTCGTAGATTTTACATGGAGAACGCGGCAAAAAGCGACGTTCAAGTTCTGTGTCATAA 1250k1260k1270kJoined ... 35:D610-617.7. Satou Y, Yamada L, Mochizuki Y, Takatori N, Kawashima T, Sasaki A, Hamaguchi M, Awazu S, Yagi K, Sasakura Y, Nakayama A, Ishikawa H,Inaba K, Satoh N: A cDNA resource from the basal chordateCiona...
- 11
- 273
- 0
Báo cáo y học: "The 3-hydroxy-3-methylglutaryl coenzyme-A (HMG-CoA) reductases" pdf
... solfataricus Archaea U95360Oceanobacillus iheyensis Archaea NC_004193Thermoplasma volcanium Archaea BAB60335Halobacterium sp Archaea AAG20075Methanosarcina mazei Archaea AAM30031Haloarcula ... Archaea AAL81972Pyrococcus abyssi Archaea AJ248284Methanococcus maripaludis Archaea CAF29643Methanocaldococcus jannaschii Archaea AAB98699Methanosarcina acetivorans Archaea AAM06446.Methanopyrus ... overall similarity in how they bind statins, whichinhibit activity by blocking access of HMG-CoA to the activesite. There is a considerable difference in specific interac-tions with inhibitor...
- 7
- 252
- 0
Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"
... registration of each incident (not theindividual patient). The AMIS form contains basic infor-mation about the situation, the patient(s), all availablelogistics (date, time registration for incoming ... situation. NACA 4-6 indi-cates potentially (4) and definitely life-threateningmedical situations (5 and 6) and NACA 7 is a deadperson. NACA scores were classified prospectively inpatients transported ... classified from 0 to 7, zero indicatingno disease or injury, while seven indicates the patientbeing dead. NACA score was in the analyses cate-gorised as NACA 0-1, indicating a patient either...
- 9
- 784
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015