Báo cáo y học: " High-Temperature unfolding of a trp-Cage mini-protein: a molecular dynamics simulation study" potx

Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot

Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot

... have successfully expressed an active fusion protein of human CNTF and human soluble CNTF-R in mammalian cells. Hyper-CNTF has a calculated molecular mass of 60 kDa and apparent molecular mass ... enhanced interleukin-6 type pleiotropic activities. Eur. Cyt. Netw. 8, 359–365. 36. Fukada, T., Hibi, M., Yamanaka, Y. , Takahashi Tezuka, M., Fujitani, Y. , Yamaguchi, T., Nakajima, K....

Ngày tải lên: 22/02/2014, 07:20

9 442 0
Báo cáo Y học: Balanced expression of single subunits in a multisubunit protein, achieved by cell fusion of individual transfectants docx

Báo cáo Y học: Balanced expression of single subunits in a multisubunit protein, achieved by cell fusion of individual transfectants docx

... D., Abrams, D. & Yarranton, G.T. (1992) High-level expression of a recombinant antibody from myeloma cells using a glutamine synthetase gene as an amplifiable selectable marker Biotechnology 10, ... all the clones demonstrated that a sufficient amount of J-chain was available for SIgA complex formation. One SIgA-producing clone (SIgA-3) along with pIgA-D and IgA-29 were analysed b...

Ngày tải lên: 18/03/2014, 01:20

6 371 0
Báo cáo y học: "Clinical Management of Adult Patients with a History of Nonsteroidal Anti-Inflammatory Drug–Induced Urticaria/ Angioedema: Update" ppt

Báo cáo y học: "Clinical Management of Adult Patients with a History of Nonsteroidal Anti-Inflammatory Drug–Induced Urticaria/ Angioedema: Update" ppt

... Paracetamol (acetaminophen) hypersensitivity. Ann Allergy Asthma Immunol 2000;85:508–11. 38. Grant JA, Weiler JM. A report of a rare immediate reaction after ingestion of acetaminophen. Ann Allergy Asthma ... Patients with NSAID-Induced Urticaria/Angioedema 29 ORIGINAL ARTICLE Clinical Management of Adult Patients with a History of Nonsteroidal Anti-Inflammatory Drug–Induced Urt...

Ngày tải lên: 08/08/2014, 21:20

7 488 0
Báo cáo y học: "Stigmatising attitude of medical students towards a psychiatry label." pot

Báo cáo y học: "Stigmatising attitude of medical students towards a psychiatry label." pot

... students towards a psychiatry label Olawale O Ogunsemi*, Olatunde Odusan and Michael O Olatawura Address: Olabisi Onabanjo University Teaching Hospital, Sagamu, Ogun State, Nigeria Email: Olawale O ... waleogunsemi@yahoo.com; Olatunde Odusan - tunsan2001@yahoo.com; Michael O Olatawura - dareolatawura@yahoo.com * Corresponding author Abstract Background: The aim of this study is to evalu...

Ngày tải lên: 08/08/2014, 23:21

4 347 0
Báo cáo y học: "Immunomodulatory properties of mesenchymal stem cells: a review based on an interdisciplinary meeting held at the Kennedy Institute" potx

Báo cáo y học: "Immunomodulatory properties of mesenchymal stem cells: a review based on an interdisciplinary meeting held at the Kennedy Institute" potx

... modulated successfully in case reports and small series, with apparently low acute toxicity [57,63]. Long-term safety data are needed. Scanty and sometimes contradictory AD animal data are available. Although ... hand, MSCs may also actively participate in initiating AD [3], they have the potential to favour spread of melanoma metastases [4] and, although mostly immune privileged, they may...

Ngày tải lên: 09/08/2014, 08:23

10 559 0
Báo cáo y học: "Extracellular localization of galectin-3 has a deleterious role in joint tissues" docx

Báo cáo y học: "Extracellular localization of galectin-3 has a deleterious role in joint tissues" docx

... Base pairs Reference ADAMTS-5 S: GGCATCATTCATGTGACAC AS: GCATCGTAGGTCTGTCCTG 364 MMP-3 S: GAAAGTCTGGGAAGAGGTGACTCCAC AS: CAGTGTTGGCTGAGTGAAAGAGACCC 284 Osteocalcin S: CATGAGAGCCCTCACA AS: AGAGCGACACCCTAGAC 310 ... AGAGCGACACCCTAGAC 310 [48] Alkaline phosphatase S: TGCAGTACGAGCTGAACAG AS: TGAAGACGTGGGAATGGTC 267 Type I collagen α1 chain S: CCGAAGGTTCCCCTGGACGA AS: CGCCCTGTTCGCCTGTCTCA 252 18S...

Ngày tải lên: 09/08/2014, 10:20

9 351 0
Báo cáo y học: "Preclinical characterization of DEKAVIL (F8-IL10), a novel clinical-stage immunocytokine which inhibits the progression of collagen-induced arthritis" ppsx

Báo cáo y học: "Preclinical characterization of DEKAVIL (F8-IL10), a novel clinical-stage immunocytokine which inhibits the progression of collagen-induced arthritis" ppsx

... followed by biotinylated goat anti-rabbit IgG anti- body (Biospa, Milan, Italy) and streptavidin-alkaline phos- phatase (SAP) complex (Biospa, Milan, Italy). Fast Red TRSalt (Sigma-Aldrich, St ... biological active antibody and cytokine moieties by binding assays on recombinant antigen and by MC/9 cell proliferation assays. We have also characterized the ability of F8-IL10 to inhibit arthri...

Ngày tải lên: 09/08/2014, 14:22

15 267 0
Báo cáo y học: "Genome sequence of the stramenopile Blastocystis, a human anaerobic parasite" doc

Báo cáo y học: "Genome sequence of the stramenopile Blastocystis, a human anaerobic parasite" doc

... acetyl-CoA carboxylase; 2, 3-oxoacyl-ACP synthase; 3, 3-oxoacyl-ACP reductase; 4, 2-enoyl-ACP reductase; 5, methylmalonyl-CoA mutase; 6, methylmalonyl-CoA epimerase; 7, propionyl- CoA carboxylase; AAC, ... 3- hydroxyisobutyrate dehydrogenase; LC-ACS, long-chain acyl-CoA synthetase; MDH, malate dehydrogenase; OMC, oxoglutarate/malate carrier protein; Pyr C, pyruvate carboxylase; SCS, succinyl-...

Ngày tải lên: 09/08/2014, 22:24

16 391 0
Báo cáo y học: "The discovery of potential acetylcholinesterase inhibitors: A combination of pharmacophore modeling, virtual screening, and molecular docking studies" pptx

Báo cáo y học: "The discovery of potential acetylcholinesterase inhibitors: A combination of pharmacophore modeling, virtual screening, and molecular docking studies" pptx

... 268:17083-17095. 18. Barak D, Kronman C, Ordentlich A, Ariel N, Bromberg A, Marcus D, Lazar A, Velan B, Shafferman A: Acetylcholinesterase peripheral anionic site degeneracy conferred by amino acid arrays sharing ... Institute of Nuclear Energy Research. CC is a research fellow in the Depart- ment of Medical Research of Mackay Memorial Hospi- tal. HYL, WT, and YH are professors f...

Ngày tải lên: 10/08/2014, 05:21

13 390 0
Báo cáo y học: " Is distortion of the bioprosthesis ring a risk factor for early calcificatio" docx

Báo cáo y học: " Is distortion of the bioprosthesis ring a risk factor for early calcificatio" docx

... Compostela University Hospital. La Choupana, Santiago de Compostela 15706, Spain. 2 Department of Radiology, Santiago de Compostela University Hospital. La Choupana, Santiago de Compostela 15706, Spain. 3 Department ... Compostela University Hospital. La Choupana, Santiago de Compostela 15706, Spain Full list of author information is available at the end of the article Cereijo et al. Jo...

Ngày tải lên: 10/08/2014, 09:22

3 370 0
w