Báo cáo y học: "Differences in organ dysfunctions between neonates and older children: a prospective, observational, multicenter study" pot
Báo cáo Y học: Differences in the binding capacity of human apolipoprotein E3 and E4 to size-fractionated lipid emulsions pot
... raises the possibility that any one or acombination of these properties may in uence the binding of apolipoproteins to lipoprotein particles. The capacity to fractionate lipid emulsions into relatively ... apolipoprotein E3 and E4 to emulsions (Eur. J. Biochem. 269) 5941 Differences in the binding capacity of human apolipoprotein E3 and E4 to size-fractionated lipid emulsions Matthew A. Perugini1, Peter ... ApoE3 and ApoE4 with EggPtdCho /TO lipid emulsions The binding of apoE3 and apoE4 to lipid particles wasalso assessed using size-fractionated emulsions comprised of egg yolk phosphatidylcholine...
- 11
- 600
- 0
Báo cáo y học: "Glycogen synthase kinase 3, circadian rhythms, and bipolar disorder: a molecular link in the therapeutic action of lithium" docx
... CentralPage 1 of 12(page number not for citation purposes)Journal of Circadian RhythmsOpen AccessResearchGlycogen synthase kinase 3, circadian rhythms, and bipolar disorder: a molecular link ... the pathophysiology of affective disorders [6]. While there aremany differences in the molecular and genetic details of the circadian machinery in mammals and Drosophila, the basic regulatory principles are ... [21,53].Mathematical modeling of the mammalian circadian oscillator feedback loops has shown that extreme delays(~7 hr) can be achieved by varying the nuclear import rate of the PER/CRY complex, and...
- 12
- 377
- 0
Báo cáo y học: " Intricacies in the surgical management of appendiceal mucinous cystadenoma: a case report and review of the literature" ppt
... 10.1186/1752-1947-4-129Cite this article as: Khan et al., Intricacies in the surgical management of appendiceal mucinous cystadenoma: a case report and review of the litera-ture Journal of Medical Case Reports 2010, ... significant cytological atypia or invasion of the appen-diceal wall by atypical glands was noted (Figures 2 and 3). A final histopathological diagnosis of mucinous cystade-noma was made. The patient ... extensive mural calcification and someperiappendiceal stranding.Both mucinous cystadenomas and cystadenocarcino-mas have the potential to cause peritoneal seeding lead-ing to pseudomyxoma peritonei....
- 4
- 427
- 0
Báo cáo y học: " Depression in Primary care: Interpersonal Counseling vs Selective serotonin reuptake inhibitors. The DEPICS Study. A multicenter randomized controlled trial. " pot
... Open Access Depression in Primary care: Interpersonal Counseling vs Selective serotonin reuptake inhibitors. The DEPICS Study. A multicenter randomized controlled trial. Rationale and designMarco ... residents in psychiat ry or in clinical psychologywith a clinical experience of at least 2 years. Theyattended a 3-day teaching seminar on interpersonal the- ory’s foundations and IPC structure and ... article as: Menchetti et al.: Depression in Primary care: Interpersonal Counseling vs Selective serotonin reuptake inhibitors. The DEPICS Study. A multicenter randomized controll ed trial. Rationale...
- 9
- 449
- 0
Báo cáo y học: " Open Access The association between bullying and early stages of suicidal ideation in late adolescents in Greece" pdf
... association between bullying behavior and early stages of suicidal ideation in a sample of Greek adolescents and to examine whetherthis is independent of the presence of psychiatric morbidity, including ... as: Skapinakis et al.: The association between bullying and early stages of suicidal ideation in late adolescents in Greece. BMCPsychiatry 2011 11:22.Skapinakis et al. BMC Psychiatry 2011, ... perpetrators (bullying others)may differ in their suicidal risk; c) the longitudinal rela-tionship between bullying and suicidal risk could go in both directions or even bullying and suicidal behaviorsmay...
- 9
- 483
- 0
Báo cáo y học: " Changes in body weight, body composition and cardiovascular risk factors after long-term nutritional intervention in patients with severe mental illness: an observational study" docx
... Changes in body weight, body composition and cardiovascular risk factors after long-term nutritional intervention in patients with severe mental illness: an observational study. BMC Psychiatry 2011 ... Kostara C, Hannon JC: Effects of nutritional intervention on body weight and body composition of obesepsychiatric patients taking olanzapine. Nutrition 2009, 25:729-735.18. Vreeland B, Minsky S, Menza ... study aimed to investigate the effects ofa long term nutritional intervention on body weight, body fat and cardiovascular risk factors in a large number of patients with SMI.Methods: Nine hundred...
- 8
- 367
- 0
Báo cáo y học: " Differences in the ability to suppress interferon b production between allele A and allele B NS1 proteins from H10 influenza A viruses" pps
... identity and 66-70% aminoacid identity was found between the < /b> NS1 proteins. The< /b> NS allele A is more common and is the < /b> only subtypefound in < /b> mammalian-adapted isolates. In < /b> a comparison between amino ... forward5’ GGCCATGACCAACAAGTGTCTCCTCC 3’ and reverse 5’ ACAGGTTACCTCCGAAACTGAGCGC 3’ ,resulting a product of 550 bp; and b- actin forward5’ TGGGTCAGAAGGACTCCTATG 3’ and reverse5’ AGAAGAGCTATGAGCTGCCTG ... [29-34]. The < /b> N-terminal RNA binding domain binds to < /b> both sin-gle- and double-stranded RNA that might inhibit the< /b> activation and/ or signalling of antiviral proteins, such asRIG-I, PKR, OAS/RNase L, activators...
- 8
- 348
- 0
Báo cáo y học: " Differences in allergen-induced T cell activation between allergic asthma and rhinitis: Role of CD28, ICOS and CTLA-4" potx
... 4).DiscussionThe results of our ex vivo studystronglysuggestacon-trasted picture of T cell activation in allergic rhinitis and asthma, with distinct patterns of Th1, Th2 and Treg profiles and expression ... after stimulation withirrelevant rBetv1 (not shown). Role of co-receptor engagement In order to study the respective role of CD28, ICOS and CTLA-4 in T cell activation patterns in the context ... significantly in R and AR, and blockade of CD28 decreased the Th2 cytokine production, indicatingthe involvement of CD28 in Th2 cell activation in allergy. It is noteworthy that although significant...
- 10
- 292
- 0
Báo cáo y học: " Differences in susceptibility to German cockroach frass and its associated proteases in induced allergic inflammation in mice" pot
... AccessResearch Differences in susceptibility to German cockroach frass and its associated proteases in induced allergic inflammation in miceKristen Page*1,3, Kristin M Lierl1, Nancy Herman2 and Marsha ... purposes)GC frass serine proteases regulate airway inflammation and airway hyperresponsiveness in Balb/c miceFigure 4GC frass serine proteases regulate airway inflammation and airway hyperresponsiveness ... of GC frass associated proteases by using GC frass pretreatedwith aprotinin. There was no effect of removal of GC frass proteases on airway hyperresponsiveness to acetylcholine,TH2 cytokine production,...
- 12
- 392
- 0
Báo cáo y học: "Systematic review: The relation between nutrition and nosocomial pneumonia: randomized trials in critically ill patients" doc
... Open AccessSystematic review: The relation between nutrition and nosocomial pneumonia: randomized trials in critically ill patientsDeborah Cook1, Bernard De Jonghe2, Daren Heyland3AbstractObjective: ... enteral nutrition [23], in another study the pneumonia rate was significantly lower in the enteral nutrition group [24], and in the remaining two studies, the pneumonia rate was slightly higher in ... review is to critically appraise and sum-marize the randomized trials of nutritional strategies and their influence on nosocomial pneumonia in criti-cally ill patients.MethodsStudy identificationTo...
- 8
- 446
- 0
Báo cáo y học: " Differences in the mannose oligomer specificities of the closely related lectins from Galanthus nivalis and Zea mays strongly determine their eventual anti-HIV activity" pdf
... 8:10http://www.retrovirology.com/content/8/1/10Page 3 of 16 RESEARCH Open Access Differences in the mannose oligomer specificities of the closely related lectins from Galanthus nivalis and Zea mays strongly determine their eventual anti-HIV ... the mannose oligomer specificities of the closely related lectins from Galanthus nivalis and Zea mays strongly determine their eventual anti-HIV activity.Retrovirology 2011 8:10.Submit your ... carbohydrate-binding specificities of the plant lectins Galanthus nivalis (GNA) and the closely rela ted lectin from Zea mays (GNAmaize) were determined by glycan array analysis and indicatedthat...
- 16
- 319
- 0
Báo cáo y học: "Differences in HIV-related behaviors at Lugufu refugee camp and surrounding host villages, Tanzania" ppsx
... implications. Sev-eral findings point to the need for interventions thataddress HIV -behaviors in the younger age groups, espe-cially in the refugee population. This includes training,education, ... Secondly, recall biasis an important limitation in any study that includes ret-rospective questions. Thirdly, re-sampling in the camp was necessary due to repatriation and the relocation ofsome ... accessibility and utilization of spe-cific HIV interventions, and provide recommendations toimprove HIV programs among refugees in Lugufu camp and the surrounding host populations in Tanzania.Tanzania's...
- 14
- 276
- 0
Báo cáo y học: "Rapid development of intestinal cell damage following severe trauma: a prospective observational cohort study" doc
... local abdominal trauma was assessedusing the AIS scores of the abdomen. Scores of 0 (no abdom-Figure 1 Intestinal cell damage increased rapidly following severe traumaIntestinal cell damage ... using a Kryptor-Assay (Brahms, Henningsdorf, Germany).Statistical analysisFirst, the plasma i-FABP levels of all trauma patients on admit-tance and at days 1 and 2 were compared with healthy controlvalues. ... dataconcerning the occurrence and significance of intestinal damage after trauma remain scarce. This study investigateswhether early intestinal epithelial cell damage occurs in traumapatients...
- 7
- 165
- 0
Báo cáo y học: "Differences in organ dysfunctions between neonates and older children: a prospective, observational, multicenter study" pot
... neonates and adults [14,15]. In neonates withMODS, there is an early and prominent microvascularfailure, characterized by a generalized capillary leak and anasarca, followed by renal and hepatic dysfunctions, while ... and interpretation of data and to drafting the article. AD contributed to analysis and interpretation of data and to drafting the article and provided statisticalexpertise. All investigators commented ... study conception and design and to analysis and interpretation of data and provided statistical expertise. FPcontributed to the acquisition of data. NB and JL contributed to analysis and interpretation...
- 9
- 246
- 0
Báo cáo y học: "Differences in trauma team activation criteria among Norwegian hospitals" doc
... Scale)HypotensionMisc. respiratory symptomsVentilation ratePulse rateANATOMIC INJURYPenetrating injuryBurn injuryTwo large fracturesCrush injuryPelvic injuryFlail chestInhalation injuryLarge ... function? Yes or NoHas the hospital performed trauma team training according to the BEST1 guidelines? Yes or NoIf yes, when was the first training? DateHave you been training during the last ... hemorrhageNeurologic injuryAmputation injuryMECHANISM OF INJURYFall injuryThrown out of vehicleDeath of another individual involved in accidentProlonged extrication timePedestrian or cyclist involved in...
- 10
- 185
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyen1 differences in accounting rules between sectors and across jurisdictions2 differences in cerebral pathophysiology between off and on pump cabg surgerym yilmaz i ilikkan b erginoz e perk y intraventricular hemorrhage in preterm newborns risk factors and results from a university hospital in istanbul 8 years after pediatr int 2007 jun 49 3 341 4differences in compliment behavior between males and femalesdifferences in compliment responses between males and femalesbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP