Báo cáo y học: "Differences in organ dysfunctions between neonates and older children: a prospective, observational, multicenter study" pot

... raises the possibility that any one or a combination of these properties may in uence the binding of apolipoproteins to lipoprotein particles. The capacity to fractionate lipid emulsions into relatively ... apolipoprotein E3 and E4 to emulsions (Eur. J. Biochem. 269) 5941 Differences in the binding capacity of human apolipoprotein E3 and...

Ngày tải lên: 08/03/2014, 09:20

... Central Page 1 of 12 (page number not for citation purposes) Journal of Circadian Rhythms Open Access Research Glycogen synthase kinase 3, circadian rhythms, and bipolar disorder: a molecular link ... the pathophysiology of affective disorders [6]. While there are many differences in the molecular and genetic details of the circadian machinery in...

Ngày tải lên: 10/08/2014, 09:20

... 10.1186/1752-1947-4-129 Cite this article as: Khan et al., Intricacies in the surgical management of appendiceal mucinous cystadenoma: a case report and review of the litera- ture Journal of Medical Case Reports 2010, ... significant cytological atypia or invasion of the appen- diceal wall by atypical glands was noted (Figures 2 and 3). A final hist...

Ngày tải lên: 11/08/2014, 12:20

... Open Access Depression in Primary care: Interpersonal Counseling vs Selective serotonin reuptake inhibitors. The DEPICS Study. A multicenter randomized controlled trial. Rationale and design Marco ... residents in psychiat ry or in clinical psychology with a clinical experience of at least 2 years. They attended a 3-day teaching seminar on interp...

Ngày tải lên: 11/08/2014, 16:22

... association between bullying behavior and early stages of suicidal ideation in a sample of Greek adolescents and to examine whether this is independent of the presence of psychiatric morbidity, including ... as: Skapinakis et al.: The association between bullying and early stages of suicidal ideation in late adolescents in Greece. BM...

Ngày tải lên: 11/08/2014, 16:23

... Changes in body weight, body composition and cardiovascular risk factors after long-term nutritional intervention in patients with severe mental illness: an observational study. BMC Psychiatry 2011 ... Kostara C, Hannon JC: Effects of nutritional intervention on body weight and body composition of obese psychiatric patients taking olan...

Ngày tải lên: 11/08/2014, 16:23

... identity and 66-70% amino acid identity was found between the < /b> NS1 proteins. The < /b> NS allele A is more common and is the < /b> only subtype found in < /b> mammalian-adapted isolates. In < /b> a comparison between amino ... forward 5’ GGCCATGACCAACAAGTGTCTCCTCC 3’ and reverse 5’ ACAGGTTACCTCCGAAACTGAGCGC 3’ , resulting a product of 550 bp; and b- actin for...

Ngày tải lên: 11/08/2014, 21:21

... 4). Discussion The results of our ex vivo studystronglysuggestacon- trasted picture of T cell activation in allergic rhinitis and asthma, with distinct patterns of Th1, Th2 and Treg profiles and expression ... after stimulation with irrelevant rBetv1 (not shown). Role of co-receptor engagement In order to study the respective role of CD28, ICOS and CTLA-...

Ngày tải lên: 12/08/2014, 13:22

... Access Research Differences in susceptibility to German cockroach frass and its associated proteases in induced allergic inflammation in mice Kristen Page* 1,3 , Kristin M Lierl 1 , Nancy Herman 2 and Marsha ... purposes) GC frass serine proteases regulate airway inflammation and airway hyperresponsiveness in Balb/c miceFigure 4 GC frass serine...

Ngày tải lên: 12/08/2014, 15:21

... Open Access Systematic review: The relation between nutrition and nosocomial pneumonia: randomized trials in critically ill patients Deborah Cook 1 , Bernard De Jonghe 2 , Daren Heyland 3 Abstract Objective: ... enteral nutrition [23], in another study the pneumonia rate was significantly lower in the enteral nutrition group [24], and in the remaini...

Ngày tải lên: 12/08/2014, 18:20

... 8:10 http://www.retrovirology.com/content/8/1/10 Page 3 of 16 RESEARCH Open Access Differences in the mannose oligomer specificities of the closely related lectins from Galanthus nivalis and Zea mays strongly determine their eventual anti-HIV ... the mannose oligomer specificities of the closely related lectins from Galanthus...

Ngày tải lên: 13/08/2014, 01:20

... implications. Sev- eral findings point to the need for interventions that address HIV -behaviors in the younger age groups, espe- cially in the refugee population. This includes training, education, ... Secondly, recall bias is an important limitation in any study that includes ret- rospective questions. Thirdly, re-sampling in the camp was necessary due to repatriation and the...

Ngày tải lên: 13/08/2014, 13:21

... local abdominal trauma was assessed using the AIS scores of the abdomen. Scores of 0 (no abdom- Figure 1 Intestinal cell damage increased rapidly following severe traumaIntestinal cell damage ... using a Kryptor-Assay (Brahms, Henningsdorf, Germany). Statistical analysis First, the plasma i-FABP levels of all trauma patients on admit- tance and at days 1 and 2 were compa...

Ngày tải lên: 13/08/2014, 16:21

... neonates and adults [14,15]. In neonates with MODS, there is an early and prominent microvascular failure, characterized by a generalized capillary leak and anasarca, followed by renal and hepatic dysfunctions, while ... and interpretation of data and to drafting the article. AD contributed to analysis and interpretation of data and to drafting the article and prov...

Ngày tải lên: 13/08/2014, 21:21

... Scale) Hypotension Misc. respiratory symptoms Ventilation rate Pulse rate ANATOMIC INJURY Penetrating injury Burn injury Two large fractures Crush injury Pelvic injury Flail chest Inhalation injury Large ... function? Yes or No Has the hospital performed trauma team training according to the BEST 1 guidelines? Yes or No If yes, when was the first training? Date Have you been training dur...

Ngày tải lên: 13/08/2014, 23:21