Báo cáo y học: " Nebulized heparin is associated with fewer days of mechanical ventilation in critically ill patients: a randomized controlled trial" potx
Báo cáo y học: " Nebulized heparin is associated with fewer days of mechanical ventilation in critically ill patients: a randomized controlled trial" potx
... 0.02). Heparin administration was not associated with any increase in adverse events. Conclusions: Nebulized heparin was associated with fewer days of mechanical ventilation in critically ill patients expected ... nebulized heparin on the lungs by measuring systemic APTT levels and also markers of coagulation act ivation in pul- monary lavage fl uid. N...
Ngày tải lên: 13/08/2014, 21:21
Báo cáo y học: "Bench-to-bedside review: Preventive measures for contrast-induced nephropathy in critically ill patients" pps
... in patents who are not critically ill, specifically oral NAC on the day before and on the day of contrast administration, as well as hydration with bicarbonate. If administration of NAC is not possible, ... example administration of theophylline (a selective renal adenosine antagonist) or of fenoldopam mesylate (a selective dopamine-1 receptor agonist that increases effecti...
Ngày tải lên: 12/08/2014, 20:21
Báo cáo y học: "The relationship between gastric emptying, plasma cholecystokinin, and peptide YY in critically ill patients" ppt
... the intra-assay coefficient of variation at 50 pmol/L was 9.5%. Plasma PYY concentrations were measured by radioimmu- noassay using an antiserum raised in rabbits against human PYY (1–36) (Sigma-Aldrich) ... mediate the initial postprandial release of PYY [9,10]. In healthy humans, exogenous administration of CCK and PYY is associated with relaxation of the proximal stomach,...
Ngày tải lên: 13/08/2014, 08:21
Báo cáo y học: "Rheumatoid cachexia is associated with dyslipidemia and low levels of atheroprotective natural antibodies against phosphorylcholine but not with dietary fat in patients with rheumatoid arthritis: a cross-sectional study" pdf
... statistical analysis. Results Dietary intake and fatty acid profiles The mean dietary intake of total energy, carbohydrate, protein and fat is shown in Table 2. Compared with the Swedish Food Recommendations ... energy percentage; FA, fatty acid; MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acid; SFA, saturated fatty acid. Available online http://arthritis-research.co...
Ngày tải lên: 09/08/2014, 13:22
Báo cáo y học: " Food assistance is associated with improved body mass index, food security and attendance at clinic in an HIV program in central Haiti: a prospective observational cohort study" docx
... care by impacting a bility to take antire- troviral medications in a number of ways, including causing symptoms of nausea while taking medications on an empty stomach, increasing drug toxicity, ... I, et al: Adherence to antiretroviral therapy in Sub-Saharan Africa and North America: a meta-analysis. JAMA 2006, 296(6):679-90. 37. Bassett I, Wang B, Chetty S, et al: Loss to care...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Preoperative statin is associated with decreased operative mortality in high risk coronary artery bypass patients" pot
... osis of coronary artery disease and the statin is not always started before operation, especially in the urgent or Table 2 Study Population and results of bnivariate analysis of statin groups All ... study design, manuscript preparation, and presentation at national meeting. DAD assisted in study design and statistical analysis. KAS developed the database and performed statistical...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: "Perceived discrimination is associated with severity of positive and depression/anxiety symptoms in immigrants with psychosis: a cross-sectional study" pot
... Fresan A, De la Fuente-Sandoval C, Loyzaga C, Garcia-Anaya M, Meyenberg N, Nicolini H, Apiquian R: A force d five-dime nsional factor analysis and concurrent validity of the Positive and Negative Syndrome ... The same analy- sis using occupational status instead of educational level showed that perceived discrimination retained a signifi- cant association with PANSS depression/anxi...
Ngày tải lên: 11/08/2014, 15:22
Báo cáo y học: " Self-esteem is associated with premorbid adjustment and positive psychotic symptoms in early psychosis" doc
... self: a longitudinal study examining self-esteem, paranoia and negative symptoms in individuals with first-episode psychosis. Early Interv Psychiatry 2011, 5:150-155. 30. American Psychiatric Association: ... was administered. The investigators had all completed general training and a reliability program with regard to the TOP research study. For DSM-IV diagnostics mean o verall kap...
Ngày tải lên: 11/08/2014, 15:22
Báo cáo y học: " Low hemoglobin is associated with poor functional outcome after non-traumatic, supratentorial intracerebral hemorrhag" docx
... suggesting that anemia or even relative anemia may not be tolerated in the setting of acute brain injury. In patients with acute brain injury, physiological compensatory mechanisms such as an increase ... groups in an univariate analysis. This finding is in line with a recent study including almost 700 patients with non-traumatic ICH investigating the role of anemia on a...
Ngày tải lên: 13/08/2014, 20:21
Báo cáo y học: "Repetitive DNA is associated with centromeric domains in Trypanosoma brucei but not Trypanosoma cruzi" pot
... family Trypanosomatidae are the causative agents of African sleeping sickness (Trypanosoma brucei), American trypanosomiasis (Trypanosoma cruzi) and leishmaniasis (Leishmania spp.), diseases that ... TCTTGATAGGCGCATGTGCATGTAACC and CGAT- GGCGCAAGCAGATAGTTGTTACC. In the case of the T. bru- cei 177 bp repeat [37], a probe was generated using primers ATTAAACAATGCGCAGTTAACG and GTGTATAATA...
Ngày tải lên: 14/08/2014, 20:22