Báo cáo y học: "Norepinephrine: more of a neurohormone than a vasopressor" ppt

Báo cáo y học: "Norepinephrine: more of a neurohormone than a vasopressor" ppt

Báo cáo y học: "Norepinephrine: more of a neurohormone than a vasopressor" ppt

... early administration of nor epi- nephrine directed at achieving a target systemic per- fusion pressure was achievable through parallel increases in cardiac output and preload. Although Hamzaoui ... rather than as a rescue therapy to treat shock [6]. Abstract Septic shock causes unpredictable cardiovascular responses through adrenoreceptor-mediated changes in cardiac function and v...

Ngày tải lên: 13/08/2014, 21:21

2 157 0
 Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"

Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"

... smok- ing and cancer deaths, was not measured in this study, and the separate calculation of risk patterns in urban and rural areas was used as a surrogate analy- sis by socioeconomic status. In ... indication. Our findings revealed that better equivalence exists in urban than in rural areas, and for cancers with a high death rate than for ‘rare’ cancers. The possible expla- n...

Ngày tải lên: 26/10/2012, 09:48

9 533 1
Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot

Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot

... enhanced interleukin-6 type pleiotropic activities. Eur. Cyt. Netw. 8, 359–365. 36. Fukada, T., Hibi, M., Yamanaka, Y. , Takahashi Tezuka, M., Fujitani, Y. , Yamaguchi, T., Nakajima, K. & Hirano, ... reflected by the activation pattern of STAT3 and MAP kinases, mainly p42, were identical for BAF/3 cells stimulated with Hyper-IL-6, Hyper-CNTF, and LIF. Analysis of the biological activ...

Ngày tải lên: 22/02/2014, 07:20

9 442 0
Báo cáo Y học: Balanced expression of single subunits in a multisubunit protein, achieved by cell fusion of individual transfectants docx

Báo cáo Y học: Balanced expression of single subunits in a multisubunit protein, achieved by cell fusion of individual transfectants docx

... D., Abrams, D. & Yarranton, G.T. (1992) High-level expression of a recombinant antibody from myeloma cells using a glutamine synthetase gene as an amplifiable selectable marker Biotechnology 10, ... all the clones demonstrated that a sufficient amount of J-chain was available for SIgA complex formation. One SIgA-producing clone (SIgA-3) along with pIgA-D and IgA-29 were analysed b...

Ngày tải lên: 18/03/2014, 01:20

6 371 0
Báo cáo y học: "Clinical Management of Adult Patients with a History of Nonsteroidal Anti-Inflammatory Drug–Induced Urticaria/ Angioedema: Update" ppt

Báo cáo y học: "Clinical Management of Adult Patients with a History of Nonsteroidal Anti-Inflammatory Drug–Induced Urticaria/ Angioedema: Update" ppt

... Paracetamol (acetaminophen) hypersensitivity. Ann Allergy Asthma Immunol 2000;85:508–11. 38. Grant JA, Weiler JM. A report of a rare immediate reaction after ingestion of acetaminophen. Ann Allergy Asthma ... Patients with NSAID-Induced Urticaria/Angioedema 29 ORIGINAL ARTICLE Clinical Management of Adult Patients with a History of Nonsteroidal Anti-Inflammatory Drug–Induced Urt...

Ngày tải lên: 08/08/2014, 21:20

7 488 0
Báo cáo y học: "Stigmatising attitude of medical students towards a psychiatry label." pot

Báo cáo y học: "Stigmatising attitude of medical students towards a psychiatry label." pot

... students towards a psychiatry label Olawale O Ogunsemi*, Olatunde Odusan and Michael O Olatawura Address: Olabisi Onabanjo University Teaching Hospital, Sagamu, Ogun State, Nigeria Email: Olawale O ... waleogunsemi@yahoo.com; Olatunde Odusan - tunsan2001@yahoo.com; Michael O Olatawura - dareolatawura@yahoo.com * Corresponding author Abstract Background: The aim of this study is to evalu...

Ngày tải lên: 08/08/2014, 23:21

4 347 0
Báo cáo y học: "Immunomodulatory properties of mesenchymal stem cells: a review based on an interdisciplinary meeting held at the Kennedy Institute" potx

Báo cáo y học: "Immunomodulatory properties of mesenchymal stem cells: a review based on an interdisciplinary meeting held at the Kennedy Institute" potx

... modulated successfully in case reports and small series, with apparently low acute toxicity [57,63]. Long-term safety data are needed. Scanty and sometimes contradictory AD animal data are available. Although ... hand, MSCs may also actively participate in initiating AD [3], they have the potential to favour spread of melanoma metastases [4] and, although mostly immune privileged, they may...

Ngày tải lên: 09/08/2014, 08:23

10 559 0
Báo cáo y học: "Extracellular localization of galectin-3 has a deleterious role in joint tissues" docx

Báo cáo y học: "Extracellular localization of galectin-3 has a deleterious role in joint tissues" docx

... Base pairs Reference ADAMTS-5 S: GGCATCATTCATGTGACAC AS: GCATCGTAGGTCTGTCCTG 364 MMP-3 S: GAAAGTCTGGGAAGAGGTGACTCCAC AS: CAGTGTTGGCTGAGTGAAAGAGACCC 284 Osteocalcin S: CATGAGAGCCCTCACA AS: AGAGCGACACCCTAGAC 310 ... AGAGCGACACCCTAGAC 310 [48] Alkaline phosphatase S: TGCAGTACGAGCTGAACAG AS: TGAAGACGTGGGAATGGTC 267 Type I collagen α1 chain S: CCGAAGGTTCCCCTGGACGA AS: CGCCCTGTTCGCCTGTCTCA 252 18S...

Ngày tải lên: 09/08/2014, 10:20

9 351 0
Báo cáo y học: "Preclinical characterization of DEKAVIL (F8-IL10), a novel clinical-stage immunocytokine which inhibits the progression of collagen-induced arthritis" ppsx

Báo cáo y học: "Preclinical characterization of DEKAVIL (F8-IL10), a novel clinical-stage immunocytokine which inhibits the progression of collagen-induced arthritis" ppsx

... followed by biotinylated goat anti-rabbit IgG anti- body (Biospa, Milan, Italy) and streptavidin-alkaline phos- phatase (SAP) complex (Biospa, Milan, Italy). Fast Red TRSalt (Sigma-Aldrich, St ... biological active antibody and cytokine moieties by binding assays on recombinant antigen and by MC/9 cell proliferation assays. We have also characterized the ability of F8-IL10 to inhibit arthri...

Ngày tải lên: 09/08/2014, 14:22

15 267 0
Báo cáo y học: "Genome sequence of the stramenopile Blastocystis, a human anaerobic parasite" doc

Báo cáo y học: "Genome sequence of the stramenopile Blastocystis, a human anaerobic parasite" doc

... acetyl-CoA carboxylase; 2, 3-oxoacyl-ACP synthase; 3, 3-oxoacyl-ACP reductase; 4, 2-enoyl-ACP reductase; 5, methylmalonyl-CoA mutase; 6, methylmalonyl-CoA epimerase; 7, propionyl- CoA carboxylase; AAC, ... 3- hydroxyisobutyrate dehydrogenase; LC-ACS, long-chain acyl-CoA synthetase; MDH, malate dehydrogenase; OMC, oxoglutarate/malate carrier protein; Pyr C, pyruvate carboxylase; SCS, succinyl-...

Ngày tải lên: 09/08/2014, 22:24

16 391 0
w