Báo cáo y học: "Norepinephrine: more of a neurohormone than a vasopressor" ppt
Báo cáo y học: "Norepinephrine: more of a neurohormone than a vasopressor" ppt
... early administration of nor epi-nephrine directed at achieving a target systemic per-fusion pressure was achievable through parallel increases in cardiac output and preload.Although Hamzaoui ... rather than as a rescue therapy to treat shock [6].AbstractSeptic shock causes unpredictable cardiovascular responses through adrenoreceptor-mediated changes in cardiac function and vascular ... resuscitation. Measurements of cardiac index and derived indices of preload (end-diastolic global volume index) and stroke volume varia-tion were made at baseline and following augmentation of MAP...
- 2
- 157
- 0
Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"
... smok-ing and cancer deaths, was not measured in this study, and the separate calculation of risk patterns in urban and rural areas was used as a surrogate analy-sis by socioeconomic status. In ... indication. Our findings revealed that better equivalence exists in urban than in rural areas, and for cancers with a high death rate than for ‘rare’ cancers. The possible expla-nations may ... smoking was greater for urban males than rural males, both study groups revealed a con-sistent pattern of the effect of smoking on risk of can-cer deaths. TABLE 1. Characteristics of cases and...
- 9
- 532
- 1
Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot
... enhanced interleukin-6 type pleiotropic activities. Eur.Cyt. Netw. 8, 359–365.36. Fukada, T., Hibi, M., Yamanaka, Y. , Takahashi Tezuka, M.,Fujitani, Y. , Yamaguchi, T., Nakajima, K. & Hirano, ... reflected by the activationpattern of STAT3 and MAP kinases, mainly p42, wereidentical for BAF/3 cells stimulated with Hyper-IL-6,Hyper-CNTF, and LIF.Analysis of the biological activity of Hyper-CNTF ... concentrations) alone were able to activate theMAPK pathway. MAP kinases and STAT3 are rapidlyactivated within 10 min in response to Hyper-CNTF, thephase of activation lasting for at least 30 min...
- 9
- 442
- 0
Báo cáo Y học: Balanced expression of single subunits in a multisubunit protein, achieved by cell fusion of individual transfectants docx
... D., Abrams,D. & Yarranton, G.T. (1992) High-level expression of a recombinant antibody from myeloma cells using a glutaminesynthetase gene as an amplifiable selectable marker Biotechnology10, ... all the clones demonstrated that a sufficient amount of J-chain was available for SIgA complex formation. OneSIgA-producing clone (SIgA-3) along with pIgA-D andIgA-29 were analysed by SDS/PAGE ... Multiskan (ICN Flow, USA). The amount of IgA present in each supernatant was calculated relative to a standard preparation with known concentration.Verification of J-chain expressionTo examine...
- 6
- 371
- 0
Báo cáo y học: "Clinical Management of Adult Patients with a History of Nonsteroidal Anti-Inflammatory Drug–Induced Urticaria/ Angioedema: Update" ppt
... Paracetamol(acetaminophen) hypersensitivity. Ann Allergy Asthma Immunol2000;85:508–11.38. Grant JA, Weiler JM. A report of a rare immediate reaction afteringestion of acetaminophen. Ann Allergy Asthma ... Patients with NSAID-Induced Urticaria/Angioedema 29ORIGINAL ARTICLEClinical Management of Adult Patients with a History of Nonsteroidal Anti-Inflammatory Drug–Induced Urticaria/Angioedema: ... Szczeklik A. Adverse reactions to aspirin and nonsteroidal anti-inflammatory drugs. Ann Allergy 1987;57:113–8.9. Papa G, Romano A, Del Bono A, et al. Floctafenine: a validalternative in patients...
- 7
- 487
- 0
Báo cáo y học: "Stigmatising attitude of medical students towards a psychiatry label." pot
... students towards a psychiatry labelOlawale O Ogunsemi*, Olatunde Odusan and Michael O OlatawuraAddress: Olabisi Onabanjo University Teaching Hospital, Sagamu, Ogun State, NigeriaEmail: Olawale O ... waleogunsemi@yahoo.com; Olatunde Odusan - tunsan2001@yahoo.com; Michael O Olatawura - dareolatawura@yahoo.com* Corresponding author AbstractBackground: The aim of this study is to evaluate ... effect of a psychiatric label attached to anapparently normal person on the attitude of final year medical students at a Nigerian university.Methods: A questionnaire with sections on demographic...
- 4
- 347
- 0
Báo cáo y học: "Immunomodulatory properties of mesenchymal stem cells: a review based on an interdisciplinary meeting held at the Kennedy Institute" potx
... modulatedsuccessfully in case reports and small series, with apparentlylow acute toxicity [57,63]. Long-term safety data are needed.Scanty and sometimes contradictory AD animal data areavailable. Although ... hand, MSCs may also actively participate ininitiating AD [3], they have the potential to favour spread of melanoma metastases [4] and, although mostly immuneprivileged, they may under certain ... potentialorchestrators of bone and cartilage repair, it has becomeapparent in recent years that they may also have profoundimmunomodulatory effects. Around 70 people participated inthis 1-day...
- 10
- 559
- 0
Báo cáo y học: "Extracellular localization of galectin-3 has a deleterious role in joint tissues" docx
... Base pairs ReferenceADAMTS-5 S: GGCATCATTCATGTGACACAS: GCATCGTAGGTCTGTCCTG364MMP-3 S: GAAAGTCTGGGAAGAGGTGACTCCACAS: CAGTGTTGGCTGAGTGAAAGAGACCC284Osteocalcin S: CATGAGAGCCCTCACAAS: AGAGCGACACCCTAGAC310 ... AGAGCGACACCCTAGAC310 [48]Alkaline phosphatase S: TGCAGTACGAGCTGAACAGAS: TGAAGACGTGGGAATGGTC267Type I collagen α1 chain S: CCGAAGGTTCCCCTGGACGAAS: CGCCCTGTTCGCCTGTCTCA25218S S: GAATCAGGGTTCGATTCCGAS: ... & Therapy Vol 9 No 1 Janelle-Montcalm et al.Page 4 of 9(page number not for citation purposes)Statistical analysisData are expressed as mean ± SEM or median (range). Statis-tical analyses...
- 9
- 351
- 0
Báo cáo y học: "Preclinical characterization of DEKAVIL (F8-IL10), a novel clinical-stage immunocytokine which inhibits the progression of collagen-induced arthritis" ppsx
... followed by biotinylated goat anti-rabbit IgG anti-body (Biospa, Milan, Italy) and streptavidin-alkaline phos-phatase (SAP) complex (Biospa, Milan, Italy). Fast Red TRSalt(Sigma-Aldrich, St ... biological active antibodyand cytokine moieties by binding assays on recombinant antigenand by MC/9 cell proliferation assays. We have alsocharacterized the ability of F8-IL10 to inhibit arthritis ... 6:2337-2342.17. Pini A, Viti F, Santucci A, Carnemolla B, Zardi L, Neri P, Neri D:Design and use of a phage display library. Human antibodieswith subnanomolar affinity against a marker of angiogenesiseluted...
- 15
- 266
- 0
Báo cáo y học: "Genome sequence of the stramenopile Blastocystis, a human anaerobic parasite" doc
... acetyl-CoA carboxylase; 2, 3-oxoacyl-ACPsynthase; 3, 3-oxoacyl-ACP reductase; 4, 2-enoyl-ACP reductase; 5, methylmalonyl-CoA mutase; 6, methylmalonyl-CoA epimerase; 7, propionyl-CoA carboxylase; AAC, ... 3-hydroxyisobutyrate dehydrogenase; LC-ACS, long-chain acyl-CoA synthetase; MDH, malate dehydrogenase; OMC, oxoglutarate/malate carrierprotein; Pyr C, pyruvate carboxylase; SCS, succinyl-CoA synthetase; ... AAC, ATP/ADP translocator; ACP, acyl carrier protein; ALAT, alanine aminotransferase; BC-AAT, branched-chain amino acidaminotransferase; C I, complex I; ECH, enoyl-CoA hydratase; [Fe]-Hyd, [Fe]-hydrogenase;...
- 16
- 391
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật