Báo cáo y học: "Bacterial flagellin elicits widespread innate immune defense mechanisms, apoptotic signaling, and a sepsis-like systemic inflammatory response in mice" ppsx

... citation purposes) Conflict and Health Open Access Research Impact of the Kenya post-election crisis on clinic attendance and medication adherence for HIV-infected children in western Kenya Rachel ... care system during the time of the post-election crisis. We used purposive sampling to iden- tify key informants, including physicians, nurses, and...

Ngày tải lên: 25/10/2012, 10:31

... nutrient intake and physical activity. In assessing the nutrient intake of persons with bipolar disorder, Elmslie and colleagues found that they had increased intake of carbohydrates and sweets, ... Pharmacotherapy and affective epi- sodes both influence appetite and physical activity, thereby increasing the risk for obesity. Obesity in bipolar patients is corr...

Ngày tải lên: 25/10/2012, 10:51

... 8(4):345-350 Case Report Foramen Magnum Arachnoid Cyst Induces Compression of the Spinal Cord and Syringomyelia: Case Report and Literature Review Haiyan Huang 1* , Yuanqian Li 1* , Kan Xu 1* , Ye Li 2 , ... Key words: foramen magnum; arachnoid cyst; syringomyelia. Introduction The commonest type of arachnoid cyst that causes compression o...

Ngày tải lên: 25/10/2012, 11:00

... â Ivyspring International Publisher. All rights reserved Research Paper Ultra-low microcurrent in the management of diabetes mellitus, hyper- tension and chronic wounds: Report of twelve cases ... abnormalities and diseases such as type 2 diabetes mellitus, obesity and the metabolic syndrome (30). In these conditions there is an elevation of bot...

Ngày tải lên: 26/10/2012, 09:39

... of NF -kB DNA DNA, PNA–PNA and PDP–PDP and GATA-1 and NF-IL2 DNA DNA hybrids on the interaction between crude nuclear extracts from B-lymphoid Raij cells and 32 P-labelled HIV-1 NF -kB DNA DNA target ... 5 0 - TAATATGT AAAAACATT-3 0 (sense strand, NF-IL 2A) , 5 0 - CACTTGAT AACAGAAAGTGATAACTCT-3 0 (sense strand, GATA-1) and 5 0 -CATGTTATGCATATTCCTGTA- AGTG-3 0 (sense stra...

Ngày tải lên: 24/03/2014, 04:21

... online http://arthritis-research.com/content/5/5/R241 Research article High CXCR3 expression in synovial mast cells associated with CXCL9 and CXCL10 expression in inflammatory synovial tissues of ... of strong CXCR3 protein signals in mast cells within the sublining areas of rheumatoid synovial tissues was found. Sequential sections of par...

Ngày tải lên: 09/08/2014, 01:23

... Research and Therapy Open Access Review Bacterial vaginosis and human immunodeficiency virus infection Gregory T Spear*, Elizabeth St John and M Reza Zariffard Address: Department of Immunology/Microbiology, ... Spear GT: Activation of human immunodeficiency virus type 1 expression by Gard- nerella vaginalis. J Infect Dis 1999, 179:924-930. 39. Al-Harthi L, Roebuck KA, Oli...

Ngày tải lên: 10/08/2014, 05:20

... in lung carcinogenesis, concluding that inflammation increases the risk for incident lung cancer [2-5]. Numerous studies on lung cancer have pointed out the appearance of Mycoplasma strains in ... of bacterial and fungal microflora in surgically removed tis- sue samples of patients with lung cancer, by using PCR methods and special primers. Materials and metho...

Ngày tải lên: 10/08/2014, 09:22

... respectively: 5'-GGATCCCGCAG GCC A A AG AC A AC A ATAG T GGTGCCAGTCAAGAGCTGGCACCACTATTGTTG TCTTTGGCCTGtcgtcagctcgtgccgtaag TGAA AC TAGT TACCAGATCATAACAACCCTCA AGAGG GTTGT TATGATC TGGTAACTAGTT TCA TTTTTTCTAGA-3' ... 5'- AGGCATGCCCATTGTTATCTG -3' and 5'- GAGA- CAATCGCGAACATCTAC -3', 5'- ATTCCACCCGCA TGGAGTTC -3' and 5'- CGGTGATGTTCGTCAG- GA...

Ngày tải lên: 12/08/2014, 04:20

... tetra- cycline derivatives (minocycline, doxycycline, tetracy- cline, and chlortetracycline) for their potential to inhibit PAD4 activity. Chlortetracycline was identifi ed as the most potent inhibitor ... protein [7]. Abstract Peptidylarginine deiminases (PADs) convert arginine within a peptide (peptidylarginine) into peptidylcitrulline. Citrullination by human PADs is importa...

Ngày tải lên: 12/08/2014, 12:20

... al.: Analysis of IL-17 + cells in facet joints of patients with spondyloarthritis suggests that the innate immune pathway might be of greater relevance than the Th17-med iated adaptive immune response. ... 6 of 9 RESEARCH ARTICLE Open Access Analysis of IL-17 + cells in facet joints of patients with spondyloarthritis suggests that the innate i...

Ngày tải lên: 12/08/2014, 17:21

... of Bacterial Community Diversity in Cystic Fibrosis Lung Infections Using 16S rDNA Terminal Restric- tion Fragment Length Polymorphism Profiling. J Clin Microbiol in press. 13. Brook I, Fink ... Cystic Fibrosisbacterial infections16S rDNAT-RFLP profilingbacterial activity Abstract Background: Chronic lung infections are the primary cause of morbidity and mortality in Cyst...

Ngày tải lên: 12/08/2014, 18:21

... pro -inflammatory cytokines. Levels of inflammatory cytokines, measured by ELISA, in (a) lung, (b) liver, (c) gut and (d) kidney, at baseline and one and three hours after flagellin administration ... article as: Rolli et al.: Bacterial flagellin elicits widespread innate immune defense mechanisms, apoptotic signaling, and a sepsis- like systemic inflamma...

Ngày tải lên: 13/08/2014, 21:21

... potyvirus potato virus Y (PVY). In this case, expression of the VSR Hc- Pro from PVY causes hyperaccumulation of PVX [15]. Inter- estingly, the synergism only occurs in one direction - PVY accumulates ... time. These pathogens may have neutral effects on one another, but more frequently they are antagonistic or synergistic. In some cases this may be due to the host’s choice of defen...

Ngày tải lên: 14/08/2014, 21:20

... predominantly control anabolic pathways by mainly targeting enzymes located at the branching points of pathways, whereas indirect feedback occurred in both the catabolic and anabolic pathways with- out ... by invading the host cell. This suicidal act not only kills most of the invaders but also wipes out many competitor gut commensals, thereby clearing the way for a more successful infection...

Ngày tải lên: 14/08/2014, 21:20