Báo cáo y học: " Effects of different fibrinogen concentrations on blood loss and coagulation parameters in a pig model of coagulopathy with blunt liver injury" docx

Báo cáo y học: " Effects of different fibrinogen concentrations on blood loss and coagulation parameters in a pig model of coagulopathy with blunt liver injury" docx

Báo cáo y học: " Effects of different fibrinogen concentrations on blood loss and coagulation parameters in a pig model of coagulopathy with blunt liver injury" docx

... work is properly cited. Research Effects of different fibrinogen concentrations on blood loss and coagulation parameters in a pig model of coagulopathy with blunt liver injury Oliver Grottke* 1,2 , ... effect. In addition, the induction of injury was performed in anaesthetised healthy pigs. Thus, the physiological response to such things as pain...

Ngày tải lên: 13/08/2014, 20:21

9 420 0
Báo cáo y học: "Hypoxic conditions increase hypoxia-inducible transcription factor 2α and enhance chondrogenesis in stem cells from the infrapatellar fat pad of osteoarthritis patients" pps

Báo cáo y học: "Hypoxic conditions increase hypoxia-inducible transcription factor 2α and enhance chondrogenesis in stem cells from the infrapatellar fat pad of osteoarthritis patients" pps

... COL1 0A1 , 5'- TACCTTGTGCCTCCCATTCAA-3' (forward) and 5'-TACAG- TACAGTGCATAAATAAATAATATATCTCCA-3' (reverse); COL1 1A2 , 5'-CCTGAGCCACTGAGTATGTTCATT-3' (for- ward) and 5'-TTGCAGGATCAGGGAAAGTGA-3' ... 5'- CACCAGATATCGACAGAGTGGTCTT-3' (forward) and 5'- CAGGGTTAAAGGCAAAGGGATAA-3' (reverse); SOX9, 5'- CTTTGGTTTGTGTTCGTGTTTTG-3&...

Ngày tải lên: 09/08/2014, 10:20

9 307 0
Báo cáo y học: "Type I interferon receptor controls B-cell expression of nucleic acid-sensing Toll-like receptors and autoantibody production in a murine model of lupus" doc

Báo cáo y học: "Type I interferon receptor controls B-cell expression of nucleic acid-sensing Toll-like receptors and autoantibody production in a murine model of lupus" doc

... several key features of human SLE, including kidney pathology, IFN-I pathway activation, autoantibody production, and induction of apoptosis. Conclusions In summary, our data demonstrate a novel ... conception of the study idea and participated in its design, data analysis, and the writing of the manuscript. All authors read and approved the final manuscript. Available o...

Ngày tải lên: 09/08/2014, 14:22

10 408 0
Báo cáo y học: "Comparative study between the Hybrid Capture II test and PCR based assay for the detection of human papillomavirus DNA in oral submucous fibrosis and oral squamous cell carcinoma" pdf

Báo cáo y học: "Comparative study between the Hybrid Capture II test and PCR based assay for the detection of human papillomavirus DNA in oral submucous fibrosis and oral squamous cell carcinoma" pdf

... in Allahabad, India. Asian Pac J Cancer Prev 2008, 9(2):263-5. 5. Chaudhary AK, Singh M, Sundaram S, Mehrotra R: Role of human papillomavirus and its detection in potentially malignant and malignant head ... of human papillomavirus DNA in oral submucous fibrosis and oral squamous cell carcinoma Ajay Kumar Chaudhary 1,2* , Shruti Pandya 2 , Ravi Mehrotra 2 , Alok C Bharti 4 , M...

Ngày tải lên: 12/08/2014, 01:22

10 454 0
Báo cáo y học: " Candida soluble cell wall β-glucan facilitates ovalbumin-induced allergic airway inflammation in mice: Possible role of antigen-presenting cells" ppt

Báo cáo y học: " Candida soluble cell wall β-glucan facilitates ovalbumin-induced allergic airway inflammation in mice: Possible role of antigen-presenting cells" ppt

... cytokines and chemokines, with a possible link to the activation of signal transducer and activator of tran- scription (STAT)6 [15], implicating that CSBG can induce/facilitate allergic airway inflammation, ... group Histological findings of hematoxylin and eosin (H&E)-stained lungsFigure 2 Histological findings of hematoxylin and eosin (H&E)- stained lungs. The 4...

Ngày tải lên: 12/08/2014, 14:20

12 246 0
Báo cáo y học: "Parenteral versus enteral nutrition: effect on serum cytokines and the hepatic expression of mRNA of suppressor of cytokine signaling proteins, insulin-like growth factor-1 and the growth hormone receptor in rodent sepsis" pps

Báo cáo y học: "Parenteral versus enteral nutrition: effect on serum cytokines and the hepatic expression of mRNA of suppressor of cytokine signaling proteins, insulin-like growth factor-1 and the growth hormone receptor in rodent sepsis" pps

... signaling by a negative feedback loop involving the janus kinase and signal transducer and activator pathway [12]. Yumet and colleagues [13] have recently shown in rats with abdominal sepsis that total ... common cellular receptor. The suppressors of cytokine signaling (SOCS) proteins are inhibitors of cytokine and GH signaling via the janus kinase and signal transducer a...

Ngày tải lên: 13/08/2014, 08:20

8 319 0
Báo cáo y học: "Are bone erosions detected by magnetic resonance imaging and ultrasonography true erosions? A comparison with computed tomography in rheumatoid arthritis metacarpophalangeal joints" pptx

Báo cáo y học: "Are bone erosions detected by magnetic resonance imaging and ultrasonography true erosions? A comparison with computed tomography in rheumatoid arthritis metacarpophalangeal joints" pptx

... modalities were evaluated with investigators blinded to clinical and other imaging data. Each MCP joint quadrant (radial and ulnar part of the metacarpal head and phalangeal base, respectively) ... [31] involved in the present study, evaluations of magnetic resonance images and the US examination were done only once. CT, being less validated in RA, was evaluated by two reade...

Ngày tải lên: 09/08/2014, 08:22

9 376 0
Báo cáo y học: "Human meniscus cells express hypoxia inducible factor-1α and increased SOX9 in response to low oxygen tension in cell aggregate culture" ppsx

Báo cáo y học: "Human meniscus cells express hypoxia inducible factor-1α and increased SOX9 in response to low oxygen tension in cell aggregate culture" ppsx

... CTTGTTTACAGTCTGCTCA-AAATATCTT P4Hα(I) Forward 5'-3' GCAGGGTGGTAATATTGGCATT Reverse 5'-3' AAATCAATTCCCTCATCACTGAAAG, P4Hα(II) Forward 5'-3'TTAGCTGTCTAGCGCCTAGCAA Reverse ... AGCTTCTGTGGAACCATGGAA COL 2A1 Forward 5'-3' CTGCAAAATAAAATCTCGGTGTTCT Reverse 5'-3' GGGCATTTGACTCACACCAGT HIF-1α Forward 5-3' GTAGTTGTGGAAGT-TTATGCTAATATTGTGT Reverse...

Ngày tải lên: 09/08/2014, 10:20

9 356 0
Báo cáo y học: "Advanced glycation end products induce cell cycle arrest and proinflammatory changes in osteoarthritic fibroblast-like synovial cells" doc

Báo cáo y học: "Advanced glycation end products induce cell cycle arrest and proinflammatory changes in osteoarthritic fibroblast-like synovial cells" doc

... capacity of AGEs to modulate FLS towards inflammation and cartilage degradation and amplify OA [17]. As the RAGE gene promoter region contains NFκB binding sites NFκB activation could increase ... BrdU incorporation was measured by a colorimetric assay as a parameter for DNA synthesis. For evaluation of cell viability and metabolic activity the MTT assay was used. The assay is b...

Ngày tải lên: 09/08/2014, 14:22

19 395 0
Báo cáo y học: "The relationship between disease activity, sleep, psychiatric distress and pain sensitivity in rheumatoid arthritis: a cross-sectional study" docx

Báo cáo y học: "The relationship between disease activity, sleep, psychiatric distress and pain sensitivity in rheumatoid arthritis: a cross-sectional study" docx

... [23-27] among healthy individuals and individuals with non-inflammatory pain syndromes; prevalent among the RA population [5,28-31]; and associated with reported pain severity among RA patients ... predicts pain and not vice versa [57]. However, RA pain differs from fibromyalgia pain because RA pain frequently has an inflammatory component. Localized, inflammatory pain may cause sle...

Ngày tải lên: 09/08/2014, 14:22

11 563 0
w