Báo cáo y học: "Leptin in sepsis: a well-suited biomarker in critically ill patients" doc

Báo cáo y học: "Recommendations for the intra-hospital transport of critically ill patients" doc

Báo cáo y học: "Recommendations for the intra-hospital transport of critically ill patients" doc

... managing critically- ill adult patients in order to avoid complications during IHT. Materials and methods Digital research was carried out via the MEDLINE, EMBASE, CINAHL and HEALTHSTAR databases ... and accompanied by an inexperienced team is a particularly risky combination. Preparation and management are both crucial steps when transporting critically ill patients since they hav...

Ngày tải lên: 13/08/2014, 20:22

10 300 0
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

... K-12strainsusedinthisstudyarelistedin Table 1. Strains CE1514 and CE1515 were obtained by P1 transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains. To obtain strain ... immunoprecipi- tated with antisera directed against P48 and TF, analyzed on SDS/ PAGE and visualized with a PhosphorImager. (B) Quantification of data presented i...

Ngày tải lên: 08/03/2014, 09:20

8 547 0
Báo cáo y học: "WHO global campaigns: A way forward in addressing public health importance of common neurological disorders" ppt

Báo cáo y học: "WHO global campaigns: A way forward in addressing public health importance of common neurological disorders" ppt

... neurological disorders Aleksandar Janca* Address: School of Psychiatry and Clinical Neurosciences, University of Western Australia, Australia Email: Aleksandar Janca* - ajanca@cyllene.uwa.edu.au * ... Central Page 1 of 2 (page number not for citation purposes) Annals of General Hospital Psychiatry Open Access Review WHO global campaigns: A way forward in addressing public health importa...

Ngày tải lên: 08/08/2014, 20:23

2 354 0
Báo cáo y học: "B cells as a therapeutic target in autoimmune disease" doc

Báo cáo y học: "B cells as a therapeutic target in autoimmune disease" doc

... treatment studies with rituximab have created a new treatment strategy that apparently acts upstream of the current treatment regimens employing cytokine blockage and that may be well suitable ... lupus erythematosus. Available online http://arthritis-research.com/content/5/3/131 Introduction The discovery of autoantibodies in chronic inflammatory diseases initiated an era of clinical inv...

Ngày tải lên: 09/08/2014, 01:21

5 410 0
Báo cáo y học: "Exome sequencing identifies a missense mutation in Isl1 associated with low penetrance otitis media in dearisch mice" pptx

Báo cáo y học: "Exome sequencing identifies a missense mutation in Isl1 associated with low penetrance otitis media in dearisch mice" pptx

... GGACAAAGAATAACACAGATTTTCC GAACAAAGGAATGAAGAAGAGG Olfr573-ps1 7:110091057-8 AGAGGAAGTAGTACATAGGCTCATGG CTACTGAAAGAGTTAACTTAGTGGAGAGG Olfr749 14:51356853 AGACAGAATGTTGGCTAGTATGTTAGG CTAATTATCTAGATCGCCTTTGACTCC Rsf1 ... CTATATGTACAGAGGGACCAGTCTTGG Col 6a3 1:92672331 CAGGCATAAAAGATGGTGTCTCTAAG GACCAAACCAACAGCAATTGTAAAC Creb3l2 6:37284584 GATGCCCTGAGCAGAGAGG TGCAGAAAGCCAAACCTAGC Gm10859 2:5833494...

Ngày tải lên: 09/08/2014, 23:20

19 319 0
Báo cáo y học: "Antiretroviral therapy at a district hospital in Ethiopia prevents death and tuberculosis in a cohort of HIV patients." ppt

Báo cáo y học: "Antiretroviral therapy at a district hospital in Ethiopia prevents death and tuberculosis in a cohort of HIV patients." ppt

... study has com- pared HAART with no treatment in an African setting. A study using virologic and immunological end points found that HAART was equally effective in African patients [5] and challenged ... BL analyzed the data. DJ, BL and AN drafted the manuscript and approved the final version. Acknowledgements We thank the doctors, nurses, laboratory technicians and community agents of...

Ngày tải lên: 10/08/2014, 05:20

8 324 0
Báo cáo y học: " Fetal bone as a foreign body in the urinary bladder: a case report" pot

Báo cáo y học: " Fetal bone as a foreign body in the urinary bladder: a case report" pot

... the patient, diagnosis and preparation of this case report: Zulifqar Ali, Irshad Ahmad and Zikria Rasheed of the Department of Surgery, Madina Teaching Hospital, Faisalabad, Pakistan; Saadia Hameed ... Department of Pathology, Madina Teach- ing Hospital and University Medical College Faisalabad, Pakistan; and Rana Qaiser Mehmood of the Department of Pathology, Punjab Medical College, Faisalab...

Ngày tải lên: 11/08/2014, 14:20

3 360 0
Báo cáo y học: "Nonconstrictive epicarditis mimicking a cardiac mass in a 71-year-old Caucasian man: a case report and review of the literature" pot

Báo cáo y học: "Nonconstrictive epicarditis mimicking a cardiac mass in a 71-year-old Caucasian man: a case report and review of the literature" pot

... epicarditis mimicking a cardiac mass in a 71-year-old Caucasian man: a case report and review of the literature AsaMMargolis 1 , Andrew B Emmerman 1 , Mario Rascon 2 and Saima I Chaudhry* 1 Address: ... tachycardia. Laboratory analysis revealed a hemoglobin count of 7.2 g/dl and iron deficiency anemia. The patient was transfused and evaluated by endoscopic ultrasound. A polypo...

Ngày tải lên: 11/08/2014, 19:21

7 329 0
Báo cáo y học: " Electrical wire as a foreign body in a male urethra: a case report" ppsx

Báo cáo y học: " Electrical wire as a foreign body in a male urethra: a case report" ppsx

... presentation may vary from asymptomatic to swelling of external genitalia, dysuria, poor urinary stream or retention, bloody or purulent urethral discharge and ascending urinary tract infection [1,2]. Depending ... this act as an indication of an impul- sive behavior, self-punishing in nature that may aggravate to suicide [1]. The psychiatric evaluation is controversial as many of these pat...

Ngày tải lên: 11/08/2014, 19:21

3 218 0
Báo cáo y học: " Penicillium species as a rare isolate in tracheal granulation tissue: a case series" ppt

Báo cáo y học: " Penicillium species as a rare isolate in tracheal granulation tissue: a case series" ppt

... and anaerobically, Maconkey agar, Neomycin blood agar anaerobically with a metronidazole disc added on the streak 2 cm away from the inoculum, chocolate agar under 10% carbon dioxide (CO 2 ) and ... several microlaryngoscopy, laser and dilatation procedures to restore airway lumen, and had a soft silastic stent in situ to maintain luminal pat- ency. However, he continued to have recurre...

Ngày tải lên: 11/08/2014, 23:21

4 317 1
w