Báo cáo y học: "Effect of different components of triple-H therapy on cerebral perfusion in patients with aneurysmal subarachnoid haemorrhage: a systematic review" docx

... this article as: Dankbaar et al.: Effect of different components of triple-H therapy on cerebral perfusion in patients with aneurysmal subarachnoid haemorrhage: a systematic review. Critical Care ... 14:R23 http://ccforum.com/content/14/1/R23 Page 9 of 10 RESEARC H Open Access Effect of different components of triple-H therapy on cerebral p...

Ngày tải lên: 13/08/2014, 20:21

... efficacy of sitagliptin in three Japanese patients (a 91-year-old Japanese woman with type 1 diabetes, a 54-year-old Japanese man with type 2 diabetes and a 30-year-old Japanese man with features ... observed in the kid- ney (assessed on the basis of blood urea nitrogen and crea tinine levels) or liver (assessed by glutamate oxaloa- cetate transaminase, glutamate pyruva...

Ngày tải lên: 11/08/2014, 00:23

... CTTGCGAAGCTGACCTGGAA-3' (for- ward) and 5'-AGCTCAAACTTGATAGGCTTGGAGA-3' (reverse), β-actin primers for control primers as 5'-TGGCAC- CCAGCACAATGAA-3' (forward) and 5'-CTAAGTCAT- AGTCCGCCTAGAAGCA-3' ... 5'-CTAAGTCAT- AGTCCGCCTAGAAGCA-3' (reverse), Cathepsin-K primers as 5'-AGCTGCAATAGCATAATCTGAACC (forward) and 3- CGTTGTTCTTATTTCGAGCCATGA (reve...

Ngày tải lên: 12/08/2014, 11:22

... HS and YZ participated in data analysis and interpretation involving real-time PCR. EL contributed to data analysis and interpretation as well as the manuscript edition. All authors read and approved ... experimental design, data acquisition, data analysis and interpretation, and the manuscript draft and edition. QY performed the data acquisition, analysis and interpretation of cell cultu...

Ngày tải lên: 12/08/2014, 15:23

... arterial partial oxygen tension of 63 mmHg. All patients with sarcoidosis had a clinical pattern that was consistent with sarcoidosis plus histological evidence of noncaseating granulomata in the absence ... to ATS, IGBP1 or the brain expressed sequence tag (EST) in any of these sera. Con- vincingly, the index case retained a strong reaction to each of these antigens in...

Ngày tải lên: 12/08/2014, 18:20

... desired prediction accuracy was achieved. In order to avoid overfitting data, a default precision accuracy of 95% was set for each node. Finally, the A kaike Information Criterion (AIC) was used to eliminate ... Hall H, et al: Quantified pathway inhibition as a pharmacodynamic marker facilitating optimal targeted therapy dosing: Proof of principle with the AKT inhibitor perifo...

Ngày tải lên: 13/08/2014, 13:20

... with that in solid cancer or lymphoma patients. Some of the AML and ALL patients were already in a neutropenic state at the start of chemotherapy. AML and ALL patients also had a longer duration of ... peripheral and deep lymphadenopathy, and other malignant foci in lymphoma patients; and disappearance of monoclonal immunoglobulin in blood and urine and less than 5...

Ngày tải lên: 13/08/2014, 19:20

... mortality in patients with AUD may partly be expl ained by the effects of alcohol on cytokine production. Patients with AUD are known to have altered expression of pro-inflamma- tory cytokines, including ... concentra- tions. In secondary analyses, we found that patients with and without AUD had differences in cytokine expres- sion. Patients with AUD had higher lev...

Ngày tải lên: 14/08/2014, 07:21

... Abbreviations GBS, Guillain-Barré syndrome; MV, mechanical ventilation; NIMV, non-invasive mechanical ventilation. Competing interests The authors declare that they have no competing interests. Published: ... Chevret S, Bourdain F, Raphaël JC; French Cooperative Group on Plasma Exchange in Guillain-Barré Syndrome: Early predictors of mechanical ventilation in Guillain-Barré syndrom...

Ngày tải lên: 14/08/2014, 08:21

... are shown in table 1. Data analysis Initial analysis of the joint item pool was conducted in stages. First, we computed exploratory factor analyses for categorical data for each scale and for ... correlates may help to elucidate potential aetiological factors. In addition, the anxiety self-report measure used is relatively weak on ascertaining fear based items and contains rela...

Ngày tải lên: 11/08/2014, 16:21