Báo cáo y học: "Value and price of ventilator-associated pneumonia surveillance as a quality indicator" potx
Báo cáo y học: "Value and price of ventilator-associated pneumonia surveillance as a quality indicator" potx
...
http://ccforum.com/content/14/1/403
doi:10.1186/cc8189
Cite this article as: Aardema LM, et al.: Value and price of ventilator-associated
pneumonia surveillance as a quality indicator. Critical Care 2010, 14:403.
Page 2 of 2
... The paradox of ventilator-associated pneumonia prevention
measures. Crit Care 2009, 13:315.
3. Curtis JR, Cook DJ, Wall RJ, Angus DC, Bi...
Tài liệu Báo cáo Y học: Presence and regulation of the endocannabinoid system in human dendritic cells potx
... 1.
MATERIALS AND METHODS
Materials and animals
Deuterated anandamide, PalEtn and 2-AG were synthe-
sized from [
2
H
4
]palmitic acid and [
2
H
8
]arachidonic acid
and ethanolamine or glycerol as ... & Tiger, G. (2001) Fatty acid amide
hydrolase: biochemistry, pharmacology, and therapeutic possibi-
lities for an enzyme hydrolyzing anandamide, 2-arachidonoylgly-
cerol, palmito...
Báo cáo y học: "Detection and characterization of two chimpanzee polyomavirus genotypes from different subspecies" potx
... TCAGCTAATTTAGCTATATC
ChPyV-Fin GAACACAGACATGACCTGTG
ChPyV-Rin GTATAGCTGAAGCATATTTAG
ChPyV TCR assay
TCRoutF AAAGTTTTACATCATAGCAATCAGA
TCRoutR AGAGGGCTTCAATAGTCAATCCAGA
TCRinF GACCCTCTTGAAATTTTTGCCACAGT
TCRinR ... Immune-mediated hemolytic anemia;
No polyomavirus-associated lesions
Figure 4 Phylogenetic analysis of concatenated VP1 and Large T proteins from avian and mammalian polyomavir...
Báo cáo y học: " Estimation and correction of non-specific binding in a large-scale spike-in experiment" pot
... C and S
samples to be a measure of accuracy (mean of 125 probesets
with the lowest P values as calculated by Cyber-T). As a meas-
ure of precision, we have taken 1% of FC = 1 and 1% of empty
probesets ... 'down-regulated' clones, so the data are unusual
and heavily imbalanced. This dataset provides a harsh test for
normalization methods, as most of them...
Báo cáo y học: "Validation and refinement of gene-regulatory pathways on a network of physical interactions" pps
... gene-expression arrays [2], chromatin
immunoprecipitation [3], and yeast two-hybrid assays [4],
each probe different aspects of the gene-regulatory system
through genome-wide datasets. These data have spawned ... Escherichia
coli and budding yeast (Saccharomyces cerevisiae) have
been most often validated against functional databases or
previous literature [6,7]. In contrast, only a fe...
báo cáo khoa học: " Identification and characterization of plant Haspin kinase as a histone H3 threonine kinase" ppsx
... has no kinase activity [13].
To examine whether purified GST-AtHaspin has kinase
activity, an in vitro kinase assay wa s performed using
purified GST-AtHaspin and GST-AtHaspin KD (kinase
dead) ... for
Windows (GraphPad Software).
Additional material
Additional file 1: Dynamics of AtHaspin-tdTomato and GFP -a-
tubulin in tobacco BY-2 cells. Dynamics of AtHaspin-tdTomato
(magenta) and...
Báo cáo y học: "Surgical and medical emergencies on board European aircraft: a retrospective study of 10189 cases"
... data analysis and inter-
pretation of the data as well as the writing of the manuscript.
FGB participated in the data analysis and interpretation of the
study. DS participated in the data analysis, ... correspondence: Aer Lingus,
Aeroflot, Air Berlin, Air Malta, Air France, Air Scotland, Alitalia, Austrian,
bmi, British Airways, Brussels, Bulgaria Air, Condor, Croatia Airlines...
Báo cáo y học: "Aplasia and Agenesis of the Frontal Sinus in Turkish Individuals: A Retrospective Study Using Dental Volumetric Tomograph"
... unilateral absence of the frontal sinuses was seen in 0.73% and 1.22% of
cases, respectively. In one case, both agenesis and aplasia of the frontal sinus was seen (0.24%).
The low percentage of ... above a line
tangential to the supraorbital margin. Frontal sinus
aplasia was also defined by an oval-shaped sinus with
the lateral margin medial to a vertical line drawn
thro...
Báo cáo y học: " Safety and efficacy of undenatured type II collagen in the treatment of osteoarthritis of the knee: a clinical trial"
...
study were standard for OA and are widely used and
recognized as reliable, accurate, and relevant.
WOMAC scores were determined, at screening,
and baseline, as well as at days 30, 60 and 90 as ... form of arthritis, and it
is often associated with significant disability and an
impaired quality of life. Clinical and radiographic
surveys have found that the...
Báo cáo y học: "Epidemiology and Prevention of Hepatitis B Virus Infection"
... Black Americans in US (Ae), Black Africans, South Africa (Aa), Asia (Aa), India
B (Ba, Bj) Southern China (Ba), Taiwan (Ba), Vietnam (Ba), Asians in the USA, Japan (Bj)
C China (Mainland and ... and Taiwan), Japan, Thailand, Asians in the USA
D White Caucasians (Southern Europe), Arabs (North Africa and the Middle East), India
E West Africa
F Central and South America
G United S...
Từ khóa: