Báo cáo y học: "Value and price of ventilator-associated pneumonia surveillance as a quality indicator" potx
... http://ccforum.com/content/14/1/403 doi:10.1186/cc8189 Cite this article as: Aardema LM, et al.: Value and price of ventilator-associated pneumonia surveillance as a quality indicator. Critical Care 2010, 14:403. Page 2 of 2 ... The paradox of ventilator-associated pneumonia prevention measures. Crit Care 2009, 13:315. 3. Curtis JR, Cook DJ, Wall RJ, Angus DC, Bi...
Ngày tải lên: 13/08/2014, 20:21
... 1. MATERIALS AND METHODS Materials and animals Deuterated anandamide, PalEtn and 2-AG were synthe- sized from [ 2 H 4 ]palmitic acid and [ 2 H 8 ]arachidonic acid and ethanolamine or glycerol as ... & Tiger, G. (2001) Fatty acid amide hydrolase: biochemistry, pharmacology, and therapeutic possibi- lities for an enzyme hydrolyzing anandamide, 2-arachidonoylgly- cerol, palmito...
Ngày tải lên: 22/02/2014, 07:20
... TCAGCTAATTTAGCTATATC ChPyV-Fin GAACACAGACATGACCTGTG ChPyV-Rin GTATAGCTGAAGCATATTTAG ChPyV TCR assay TCRoutF AAAGTTTTACATCATAGCAATCAGA TCRoutR AGAGGGCTTCAATAGTCAATCCAGA TCRinF GACCCTCTTGAAATTTTTGCCACAGT TCRinR ... Immune-mediated hemolytic anemia; No polyomavirus-associated lesions Figure 4 Phylogenetic analysis of concatenated VP1 and Large T proteins from avian and mammalian polyomavir...
Ngày tải lên: 12/08/2014, 02:20
Báo cáo y học: " Estimation and correction of non-specific binding in a large-scale spike-in experiment" pot
... C and S samples to be a measure of accuracy (mean of 125 probesets with the lowest P values as calculated by Cyber-T). As a meas- ure of precision, we have taken 1% of FC = 1 and 1% of empty probesets ... 'down-regulated' clones, so the data are unusual and heavily imbalanced. This dataset provides a harsh test for normalization methods, as most of them...
Ngày tải lên: 14/08/2014, 07:21
Báo cáo y học: "Validation and refinement of gene-regulatory pathways on a network of physical interactions" pps
... gene-expression arrays [2], chromatin immunoprecipitation [3], and yeast two-hybrid assays [4], each probe different aspects of the gene-regulatory system through genome-wide datasets. These data have spawned ... Escherichia coli and budding yeast (Saccharomyces cerevisiae) have been most often validated against functional databases or previous literature [6,7]. In contrast, only a fe...
Ngày tải lên: 14/08/2014, 14:21
báo cáo khoa học: " Identification and characterization of plant Haspin kinase as a histone H3 threonine kinase" ppsx
... has no kinase activity [13]. To examine whether purified GST-AtHaspin has kinase activity, an in vitro kinase assay wa s performed using purified GST-AtHaspin and GST-AtHaspin KD (kinase dead) ... for Windows (GraphPad Software). Additional material Additional file 1: Dynamics of AtHaspin-tdTomato and GFP -a- tubulin in tobacco BY-2 cells. Dynamics of AtHaspin-tdTomato (magenta) and...
Ngày tải lên: 11/08/2014, 11:22
Báo cáo y học: "Surgical and medical emergencies on board European aircraft: a retrospective study of 10189 cases"
... data analysis and inter- pretation of the data as well as the writing of the manuscript. FGB participated in the data analysis and interpretation of the study. DS participated in the data analysis, ... correspondence: Aer Lingus, Aeroflot, Air Berlin, Air Malta, Air France, Air Scotland, Alitalia, Austrian, bmi, British Airways, Brussels, Bulgaria Air, Condor, Croatia Airlines...
Ngày tải lên: 25/10/2012, 10:31
Báo cáo y học: "Aplasia and Agenesis of the Frontal Sinus in Turkish Individuals: A Retrospective Study Using Dental Volumetric Tomograph"
... unilateral absence of the frontal sinuses was seen in 0.73% and 1.22% of cases, respectively. In one case, both agenesis and aplasia of the frontal sinus was seen (0.24%). The low percentage of ... above a line tangential to the supraorbital margin. Frontal sinus aplasia was also defined by an oval-shaped sinus with the lateral margin medial to a vertical line drawn thro...
Ngày tải lên: 25/10/2012, 11:04
Báo cáo y học: " Safety and efficacy of undenatured type II collagen in the treatment of osteoarthritis of the knee: a clinical trial"
... study were standard for OA and are widely used and recognized as reliable, accurate, and relevant. WOMAC scores were determined, at screening, and baseline, as well as at days 30, 60 and 90 as ... form of arthritis, and it is often associated with significant disability and an impaired quality of life. Clinical and radiographic surveys have found that the...
Ngày tải lên: 26/10/2012, 09:48
Báo cáo y học: "Epidemiology and Prevention of Hepatitis B Virus Infection"
... Black Americans in US (Ae), Black Africans, South Africa (Aa), Asia (Aa), India B (Ba, Bj) Southern China (Ba), Taiwan (Ba), Vietnam (Ba), Asians in the USA, Japan (Bj) C China (Mainland and ... and Taiwan), Japan, Thailand, Asians in the USA D White Caucasians (Southern Europe), Arabs (North Africa and the Middle East), India E West Africa F Central and South America G United S...
Ngày tải lên: 02/11/2012, 11:12