Báo cáo y học: "The leading causes of death after burn injury in a single pediatric burn cente" docx
... the majority of pediatric burn patients was male, had suffered a flame burn injury and had 23% TBSA burn. Inhalation injury was present in 20% of all admitted burns. Respiratory failure Respiratory ... syndrome (ARDS), as defined clini- cally, diffuse alveolar damage (DAD) based solely on findings at autopsy, aspiration or asphyxia, or asthma attack. ARDS was clinically def...
Ngày tải lên: 13/08/2014, 20:21
... below). Catalytically dead kinases In most kinomes, about 10% of kinases lack critical cata- lytic residues (K72, D166, D184) and are likely to be cat- alytically inactive, yet may retain signaling ... (Orf_14367) of adenylate and guany- late cyclases. No clear AKAP (A kinase anchoring pro- tein) was found. In many organisms, including Giardia, PKA localizes to the basal bodies/centr...
Ngày tải lên: 09/08/2014, 23:20
... The CaSR is important in m aintaining and regulating mineral ion homeostasis. Increasing evidence has indicated that CaSR was functionally expressed in the cardiovascular system. Wang et al showed ... China. 2 Department of Pathophysiology, Harbin Medical University, Harbin 150086, PR China. 3 Department of Pharmacology, Har bin Medical University, Harbin 150086, PR China. 4 Bio-pharm...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "The pathophysiological function of peroxisome proliferator-activated receptor-γ in lung-related diseases" pptx
... Tanahashi M, Yukiue H, Moiriyama S, Kobayashi Y, Nakashima Y, Kaji M, Kiriyama M, Fukai I, Yamakawa Y, Fujii Y: Decreased perioxisome proliferator-activated receptor gamma gene expression was ... purposes) nophil and lymphocyte influx may not be mediated by the antagonism of the NF-κB pathway [31]. Interleukin-5 (IL-5) is the principal regulatory cytokine mediating eosinophil airway i...
Ngày tải lên: 12/08/2014, 18:22
Báo cáo y học: "The temporal program of peripheral blood gene expression in the response of nonhuman primates to Ebola hemorrhagic fever" ppsx
... (lanes B and D), day 2 after infection (lane E), day 3 after infection (lane F), day 4 after infection (lanes H and J), day 5 after infection (lanes L, N, and P), day 6 after infection (lane ... smears. Cytokine and chemokine ELISAs Cytokine/chemokine levels in monkey sera/plasma were assayed using commercially available ELISA kits according to manufacturer's directions. Cyt...
Ngày tải lên: 14/08/2014, 08:20
Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"
... on all abnormalities [12]. At present, in many ICUs CXRs are still routinely obtained on a daily basis, at least in The Netherlands [13]. There may be advantages to eliminating daily routine ... 22:1335-1338. 9. Chahine-Malus N, Stewart T, Lapinsky SE, Marras T, Dancey D, Leung R, Mehta S: Utility of routine chest radiographs in a med- ical-surgical intensive care unit: a qualit...
Ngày tải lên: 25/10/2012, 10:39
Báo cáo y học: " Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals" pdf
... amplified by two primer pairs (CCR5-F1: 5'ATGGAGGGCAACTAAATACATT3'; CCR5-R1: 5'AGATGACTATCTTTAATGTCTG3'; CCR5-F2: 5'CTCTCATTTTCCATACAGTCAGTATCA3'; CCR5-R2: 5'AAGCCATGTGCACAACTCTGACTG3') ... including the mutation was obtained by using primers CD45-F: 5'-GATTGACTACAG- CAAAGATGCCC-3' and CD45-R: 5'-CCTCTGTGGTAT- TAAAAGCACTAGCA-3'; subs...
Ngày tải lên: 10/08/2014, 05:20
Báo cáo y học: "Successful surgical resection of infected left atrial myxoma in a case complicated with disseminated intravascular coagulation and multiple cerebral infarctions: case report" ppt
... report Daisuke Yoshioka, Toshiki Takahashi * , Toru Ishizaka and Takuya Higuchi Abstract Cardiac myxoma is the most common primary cardiac tumour, but infected cardiac myxoma is relatively rare. Infected ... toshiki@onh.go.jp Department of Cardiovascular surgery, Osaka National Hospital, 2-14 Hoenzaka, Chuo-ku, Osaka city, Osaka, 540-0006, Japan Yoshioka et al. Journal of Cardiothoracic S...
Ngày tải lên: 10/08/2014, 09:21
Báo cáo y học: "The evolving story of medical emergency teams in quality improvement"
... requiring substantial investments of additional resources. Academic centers are increasingly recognizing engagement in quality improvement as a distinct career pathway. Involving such physicians in ... the standardized MET form on each patient and a weekly 1-hour Commentary The evolving story of medical emergency teams in quality improvement André Carlos Kajdacsy-Balla Amaral 1...
Ngày tải lên: 25/10/2012, 10:06
Báo cáo y học: "The Versatile Use of Temporoparietal Fascial Flap"
... reconstruction with cartilage grafts covered by axial, random and free flaps of temporoparietal fascia, ana- tomical researches of temporal area gained populari- ty. 4 When its advantages are combined with ... face and scalp. In: Gray’s Anatomy The anatomical basis of clinical practice, 39th ed. Elsevier Churchill Livingstone; 2005: 497-519. 10. Mathes SJ, Nahai F. Regional Flaps...
Ngày tải lên: 25/10/2012, 11:00