Báo cáo y học: " Disinfection of the hospital water supply: a hidden risk to dialysis" ppt

Báo cáo y học: "Use of the measure your medical outcome profile (MYMOP2) and W-BQ12 (Well-Being) outcomes measures to evaluate chiropractic treatment: an observational study"

Báo cáo y học: "Use of the measure your medical outcome profile (MYMOP2) and W-BQ12 (Well-Being) outcomes measures to evaluate chiropractic treatment: an observational study"

... 19:7 http://chiromt.com/content/19/1/7 Page 7 of 8 RESEARCH Open Access Use of the measure your medical outcome profile (MYMOP2) and W-BQ12 (Well-Being) outcomes measures to evaluate chiropractic treatment: an observational study Barbara ... other than the Activity scale of the MYMOP2 which had no significant correlations with any of the...
Ngày tải lên : 25/10/2012, 10:06
  • 8
  • 538
  • 0
Báo cáo y học: "Impact of the Kenya post-election crisis on clinic attendance and medication adherence for HIV-infected children in western Kenya"

Báo cáo y học: "Impact of the Kenya post-election crisis on clinic attendance and medication adherence for HIV-infected children in western Kenya"

... citation purposes) Conflict and Health Open Access Research Impact of the Kenya post-election crisis on clinic attendance and medication adherence for HIV-infected children in western Kenya Rachel ... care system during the time of the post-election crisis. We used purposive sampling to iden- tify key informants, including physicians, nurses, and...
Ngày tải lên : 25/10/2012, 10:31
  • 10
  • 696
  • 0
Báo cáo y học: "Evaluation of the Prevalence of Concomitant Idiopathic Cyclic Edema and Cellulit"

Báo cáo y học: "Evaluation of the Prevalence of Concomitant Idiopathic Cyclic Edema and Cellulit"

... idea of the high prevalence of edema in the more advanced grades of cellulite. The lack of specific clinical and laboratory studies hinders research on cyclic edema and the dissemination of ... Evaluation of the Prevalence of Concomitant Idiopathic Cyclic Edema and Cellulite José Maria Pereira de Godoy 1  , Maria de Fátima Guerreiro de God...
Ngày tải lên : 25/10/2012, 10:51
  • 3
  • 462
  • 1
Báo cáo y học: " Reconstitution of the adult B cell repertoire after treatment with rituximab" pptx

Báo cáo y học: " Reconstitution of the adult B cell repertoire after treatment with rituximab" pptx

... heavy chain B cell repertoire in two patients with RA treated with rituximab, whose peripheral blood was analyzed before treatment and at different time Commentary Reconstitution < /b> of < /b> the < /b> adult < /b> B cell ... Indeed, the < /b> breakdown of < /b> B cell tolerance for autoantigens may be at the < /b> core of < /b> the < /b> pathogenesis of < /b>...
Ngày tải lên : 09/08/2014, 07:20
  • 2
  • 231
  • 0
Báo cáo y học: "Atrophy of the brachialis muscle after a displaced clavicle fracture in an Ironman triathlete: case report" docx

Báo cáo y học: "Atrophy of the brachialis muscle after a displaced clavicle fracture in an Ironman triathlete: case report" docx

... midshaft fracture of the clavicle makes the case even more interesting and remarkable. Case presentation In the las t two kilometres of the cycling split in an Iron- mantriathlonahighlytrainedathletehitaduckinthe street ... nerve as well as the axillar nerve and subsequently to an atrophy of the brachialis muscle. Physicians should be aware of this poten...
Ngày tải lên : 10/08/2014, 10:20
  • 4
  • 319
  • 0
Báo cáo y học: " Neurofibromatosis of the nipple-areolar area: a case series" ppt

Báo cáo y học: " Neurofibromatosis of the nipple-areolar area: a case series" ppt

... optic gliomas, other gliomas, rhabdomyosarcoma, astrocytoma and ne urofibrosarcoma and leukemias. The average life expectancy of patients with NF1 is probably reduced by 10 to 15 years, a nd malignancy ... Access Neurofibromatosis of the nipple-areolar area: a case series Maria Rita Bongiorno * , Spyridoula Doukaki, Mario Aricò Abstract Introduction: Neurofibromatosis ty...
Ngày tải lên : 11/08/2014, 14:21
  • 6
  • 467
  • 0
Báo cáo y học: " Reconstruction of the gastric passage by a side-to-side gastrogastrostomy after failed vertical-banded gastroplasty: a case report" doc

Báo cáo y học: " Reconstruction of the gastric passage by a side-to-side gastrogastrostomy after failed vertical-banded gastroplasty: a case report" doc

... purposes) Journal of Medical Case Reports Open Access Case report Reconstruction of the gastric passage by a side-to-side gastrogastrostomy after failed vertical-banded gastroplasty: a case report Christopher ... years after VBG with an inability to swallow solid food. A gastrographin swallow revealed a dilated dis- tal oesophagus and a lack of o...
Ngày tải lên : 11/08/2014, 23:21
  • 4
  • 223
  • 0
Báo cáo y học: " Activation of the SPHK/S1P signalling pathway is coupled to muscarinic receptor-dependent regulation of peripheral airways" pot

Báo cáo y học: " Activation of the SPHK/S1P signalling pathway is coupled to muscarinic receptor-dependent regulation of peripheral airways" pot

... synthesis [4,5]. In the present study we therefore tested the hypothesis that acti- vation of the SPHK/S1P signalling pathway may contrib- ute to MR-dependent regulation of peripheral airway diameter. ... of 14 (page number not for citation purposes) Respiratory Research Open Access Research Activation of the SPHK/S1P signalling pathway is coupled to...
Ngày tải lên : 12/08/2014, 18:21
  • 14
  • 282
  • 0
Báo cáo y học: " Determinants of the cuff-leak test: a physiological study" ppsx

Báo cáo y học: " Determinants of the cuff-leak test: a physiological study" ppsx

... clearly showed that the cuff-leak test (particularly its inspiratory com- ponent) is influenced by factors other than the cross-sectional area of the trachea and/or the upper airways and thus the above-mentioned ... cuff at the end of a 3 s end-inspiratory pause. Data were analyzed with a paired t-test and a multi-factorial analysis of variance for repeated measureme...
Ngày tải lên : 12/08/2014, 20:20
  • 8
  • 321
  • 0
Báo cáo y học: " Compartmentalization of the gut viral reservoir in HIV-1 infected patients" ppt

Báo cáo y học: " Compartmentalization of the gut viral reservoir in HIV-1 infected patients" ppt

... Further analysis of the Nef encoding region Viral molecular diversity of the Nef encoding region in gut tissues of HIV-1 patientsFigure 5 Viral molecular diversity of the Nef encoding region in ... protein encoding region in the colorectum may be the result of increased viral replication. This could increase the chance of pathogenic HIV-1 strains evol...
Ngày tải lên : 13/08/2014, 05:22
  • 14
  • 378
  • 0
Báo cáo y học: "Inclusion of the glucocorticoid receptor in a hypothalamic pituitary adrenal axis model reveals bistability" ppt

Báo cáo y học: "Inclusion of the glucocorticoid receptor in a hypothalamic pituitary adrenal axis model reveals bistability" ppt

... Corresponding author Abstract Background: The body's primary stress management system is the hypothalamic pituitary adrenal (HPA) axis. The HPA axis responds to physical and mental challenge ... purposes) Theoretical Biology and Medical Modelling Open Access Research Inclusion of the glucocorticoid receptor in a hypothalamic pituitary adrenal axis mo...
Ngày tải lên : 13/08/2014, 16:21
  • 12
  • 284
  • 0
Báo cáo y học: "Methemoglobinemia in critically ill patients during extended hemodialysis and simultaneous disinfection of the hospital water supply" pdf

Báo cáo y học: "Methemoglobinemia in critically ill patients during extended hemodialysis and simultaneous disinfection of the hospital water supply" pdf

... 5 Research Methemoglobinemia in critically ill patients during extended hemodialysis and simultaneous disinfection of the hospital water supply Martin Johannes Bek 1 , Sven Laule 2 , Christine Reichert-Jünger 1 , ... methemoglobinemia in patients undergoing extended daily hemodialysis/ hemodiafiltration we analyzed the relationship between methemoglobine...
Ngày tải lên : 13/08/2014, 19:20
  • 4
  • 555
  • 0
Báo cáo y học: " Disinfection of the hospital water supply: a hidden risk to dialysis" ppt

Báo cáo y học: " Disinfection of the hospital water supply: a hidden risk to dialysis" ppt

... clinical and facilities staff, who should be aware of the risks and hazards that may be posed to special patient groups if chemicals are introduced into the water supply. Guidance pertaining to ... of the water treatment system or the feed water may have on the product water used in the preparation of dialysis fluid. Such awareness requires communication and the...
Ngày tải lên : 13/08/2014, 19:20
  • 2
  • 233
  • 0
Báo cáo y học: " Analysis of the platypus genome suggests a transposon origin for mammalian imprinting" ppt

Báo cáo y học: " Analysis of the platypus genome suggests a transposon origin for mammalian imprinting" ppt

... Issue 1, Article R1 Research Analysis of the platypus genome suggests a transposon origin for mammalian imprinting Andrew J Pask Ô * , Anthony T Papenfuss Ô , EleanorIAger * , Kaighin A McColl ‡ , ... compared to the platypus. Conclusions: Our analyses show that the platypus has significantly fewer repeats of certain classes in the regions of the gen...
Ngày tải lên : 14/08/2014, 21:20
  • 8
  • 186
  • 0
Báo cáo y học: " Characterization of taxonomically restricted genes in a phylum-restricted cell type?" pptx

Báo cáo y học: " Characterization of taxonomically restricted genes in a phylum-restricted cell type?" pptx

... 116 nb035 -sv3 nb035 -sv2 nb035 -sv1 3100 2400 1400 (c) northern-probe nb035-sv2 northern-probe nb035-sv1 (a) GT AG AG AG AG AG AG GT GT GT GT GT nb035-sv3 901 AAAAGATCAGTTCATAAAAGATCTGTTGAAGGAAGGAGATTCATTTACTAA 301 K R S V H K R S V E G R R F I Y nb035-sv2 1570 GAGATTCCATTTGATCCAAGGGAAGCATATGGAAGGAGATTCATTTACTAA 521 E ... Y nb035-sv2 1570 GAGATTCCATTTGATCCAAGGGAAGCATATGGAAGGAGATTCATTTA...
Ngày tải lên : 14/08/2014, 21:20
  • 16
  • 189
  • 0