Báo cáo y học: "Effects of positive end-expiratory pressure on respiratory function and hemodynamics in patients with acute respiratory failure with and without intra-abdominal hypertension: a pilot study" docx

Báo cáo y học: " Effects of CYP2B6 G516T polymorphisms on plasma efavirenz and nevirapine levels when co-administered with rifampicin in HIV/TB co-infected Thai adults" ppt

Báo cáo y học: " Effects of CYP2B6 G516T polymorphisms on plasma efavirenz and nevirapine levels when co-administered with rifampicin in HIV/TB co-infected Thai adults" ppt

... Kumar AK, Jagan I, Vasantha M, Padmapriyadarsini C, Narendran G, Rajasekaran S, Swaminathan S: Association of high T allele frequency of CYP2B6 G516T polymorphism among ethnic south Indian HIV-infected ... n BioSciences, USA) and analyzed by FACScan flo w cytometer (Becton Dickinson BioSciences, USA.). Plasma HIV-1 RNA was determined by RT-PCR at baseline and every 12 weeks after init...

Ngày tải lên: 10/08/2014, 05:21

10 457 0
Báo cáo y học: "Effects of lifestyle physical activity on perceived symptoms and physical function in adults with fibromyalgia: results of a randomized trial" pdf

Báo cáo y học: "Effects of lifestyle physical activity on perceived symptoms and physical function in adults with fibromyalgia: results of a randomized trial" pdf

... often substantially hampers day-to-day functioning and is a primary cause of disability [5]. Even with the recent Food and Drug Administration approval of medications to treat FM, pharmacotherapy generally ... Access Effects of lifestyle physical activity on perceived symptoms and physical function in adults with fibromyalgia: results of a randomized trial Kevin R...

Ngày tải lên: 12/08/2014, 12:20

9 381 0
Báo cáo y học: " Effects of different fibrinogen concentrations on blood loss and coagulation parameters in a pig model of coagulopathy with blunt liver injury" docx

Báo cáo y học: " Effects of different fibrinogen concentrations on blood loss and coagulation parameters in a pig model of coagulopathy with blunt liver injury" docx

... effect. In addition, the induction of injury was performed in anaesthetised healthy pigs. Thus, the physiological response to such things as pain and inflam- mation may have additional effects on haemostasis, which ... suggests guiding haemostatic therapy by point -of- care testing rather than by plasma-based coagu- lation assays [29]. Following trauma, haemodilution and shock dec...

Ngày tải lên: 13/08/2014, 20:21

9 420 0
Báo cáo y học: "Effect of osteopathic manipulative treatment on gastrointestinal function and length of stay of preterm infants: an exploratory study" pot

Báo cáo y học: "Effect of osteopathic manipulative treatment on gastrointestinal function and length of stay of preterm infants: an exploratory study" pot

... effects of OMT in a population of pre- mature infants in terms of gastrointestinal functions and LOS. The medical literature lacks information of any potential benefits of complementary treatments in ... clinical symptoms of abnormal gastrointestinal function. In particular, vomit and regurgitation were found to be associated with increased esophageal acid occurre...

Ngày tải lên: 13/08/2014, 15:21

6 307 0
Báo cáo y học: "Effects of positive end-expiratory pressure on gastric mucosal perfusion in acute respiratory distress syndrome" doc

Báo cáo y học: "Effects of positive end-expiratory pressure on gastric mucosal perfusion in acute respiratory distress syndrome" doc

... was inserted into the stomach and connected to air automated tonometry (TONOCAP™ Monitor; Datex-Engstrom, Helsinki, Finland). All patients were sedated with midazolam and morphine, and par- alyzed ... enrolled. They had a median (range) age of 63.5 years (23–86), and an Acute Physiology and Chronic Health Evaluation II score of 14 (7–20) at admis- sion to the intensive c...

Ngày tải lên: 12/08/2014, 20:20

6 349 0
Báo cáo y học: "Effects of positive end-expiratory pressure on respiratory function and hemodynamics in patients with acute respiratory failure with and without intra-abdominal hypertension: a pilot study" docx

Báo cáo y học: "Effects of positive end-expiratory pressure on respiratory function and hemodynamics in patients with acute respiratory failure with and without intra-abdominal hypertension: a pilot study" docx

... function and hemodynamics in patients with acute lung injury (ALI) or acute respiratory distress syndrome (ARDS) with normal intra- abdominal pressure (IAP < 12 mmHg) and with intra-abdominal hypertension ... citation purposes) Vol 13 No 5 Research Effects of positive end-expiratory pressure on respiratory function and hemodynamics in patien...

Ngày tải lên: 13/08/2014, 19:20

11 417 0
Báo cáo y học: "Effects of evening light conditions on salivary melatonin of Japanese junior high school students" ppsx

Báo cáo y học: "Effects of evening light conditions on salivary melatonin of Japanese junior high school students" ppsx

... rhythm and sleep-wake cycle. Effects of light condition on salivary melatonin concentrationFigure 1 Effects of light condition on salivary melatonin concentration. Values shown are means (n = ... morning and then decreases again rap- idly to the extremely low concentration typical of the daytime [7,8]. The increase in melatonin concentration might occur in late evening and...

Ngày tải lên: 10/08/2014, 09:20

5 405 0
Báo cáo y học: " Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts" pdf

Báo cáo y học: " Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts" pdf

... 8:25 http://www.journal-inflammation.com/content/8/1/25 Page 7 of 7 RESEARCH Open Access Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts Linn a Asp 1 , ... encoding indoleamine 2,3-dioxygenase, kynureninase or 3-hydroxyanthranilic acid oxygenase and decreases in the levels of transcripts encoding tryptophan 2,3-dio...

Ngày tải lên: 11/08/2014, 03:20

7 457 0
Báo cáo y học: "Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts" pot

Báo cáo y học: "Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts" pot

... Sense CACATCTGGCAGCCAACAAG Anti-sense CACTGGCAACATTAATAATGTTGCA KAT3 CCBL2 Sense ACTATCAGCCATCCCCGTTTC Anti-sense AATGAAGCAAAAACGCACAAACT KAT4 GOT2 Sense TGTGGTGTGCAGCCTCTCAT Anti-sense AAGCCTGAACCCAGCTAGCA KYNU ... CTAGTAGATGCCCACTGAATATTTGTG HAAO HAAO Sense GGACGTTCTGTTTGAGAAGTGGTT Anti-sense AGCTGAAGAACTCCTGGATGATG KAT1 CCBL1 Sense CCTGCTAAGGCTCAGGTATAACCT Anti-sense GGACTCAAGCCTAAAGGCAACT...

Ngày tải lên: 11/08/2014, 06:23

7 360 0
Báo cáo y học: " Effects of supplemental fish oil on resting metabolic rate, body composition, and salivary cortisol in healthy adults" ppsx

Báo cáo y học: " Effects of supplemental fish oil on resting metabolic rate, body composition, and salivary cortisol in healthy adults" ppsx

... Kobayashi H, Ashakumary L, Rouyer IA, Takahashi Y, Aoyama T, Hashimoto T, Mizugaki M: Comparative effects of perilla and fish oils on the activity and gene expression of fatty acid oxidation ... collection, statistical analysis and manuscript preparation. MJS, MLC, VAP and LKA contributed in the design of the study, data collection, and manuscript preparation. JB contribu...

Ngày tải lên: 11/08/2014, 23:21

7 473 0
Từ khóa:
w