Báo cáo y học: " Changes in the central component of the hypothalamus-pituitary-thyroid axis in a rabbit model of prolonged critical illness" ppsx

... statistical analyses were done using StatView software (SAS Institute Inc., Cary, NC, USA). Data were analyzed using one-way analysis of variance tests. Data are presented as mean ± standard deviation. ... transport- ers MCT10 and OATP1C1 is increased in the hypotha- lamus of prolonged critically ill rabbits. • Hypothalamic T3 and T4 levels are not increased in a rabbit model...

Ngày tải lên: 13/08/2014, 19:20

... homogenate were incubated separately at 37 °Cand70°C for 15 min, then AAT activity in both samples was determined. The AAT activity of the sample incubated at 37 °Cwastakento be that of both isoenzymes (mitochondrial ... following oxygen radical injury of mitochondria during hypoxic liver reoxygenation [34]. Our data show a release of the mitochondrial matrix enzymes GDH and...

Ngày tải lên: 24/03/2014, 04:21

... rather than two points, the TPD is reached and this was recorded in the datasheet. If the subject had callosity in any of the foot area, the TPD measurement was taken in the adjacent area to the ... 600036, India and 2 Diabetic Foot Clinic, Sundaram Medical Foundation, Chennai, 600040, India Email: R Periyasamy - periyasamy25@gmail.com; M Manivannan - mani@iitm.ac .in;...

Ngày tải lên: 10/08/2014, 10:20

... of what con- stitutes a myofascial pain generator. While both 'tender points' and myofascial trigger points are painful to palpa- tion, only myofascial trigger points will fasciculate ... experimental evidence of a physiologic link between myofascial trigger points and central sensitization in patients with shoulder pain of myofascial origin. [10] In contrast, Curato...

Ngày tải lên: 10/08/2014, 10:20

... fitted the constant phase model on Rrs and Xrs data (Figure 3). Raw slightly increase in a similar way in the control and in the treated group. An increase in Raw can be associated to a reduction of ... properties of the respiratory sys- tem in vivo during interstitial lung edema measured by low-frequency FOT in absence of airway and alveolar flooding. Methodol...

Ngày tải lên: 12/08/2014, 15:21

... different roles in airway inflammation after ozone exposure. Introduction Asthma is an inflammatory disease of the airways that is characterized by airway obstruction and increased airway responsiveness ... to alter breathing patterns, and changes in Pause (timing of early and late expiration) and Penh are really due to alterations in the timing of breathing, as well as prol...

Ngày tải lên: 12/08/2014, 18:21

... linker was made by annealing S4 (5’ -PO4- CGAAGCTTCTTCTCTGCGTCAAATT CTGGATT- CTCAAAAAATGGAATGGCGTTCTAACGCTGGT- GGTTCTTT-3’ , BAD inderlined) and AS5 (5’ -PO4- GCTTAGAACCACCAGCGTTAGAAC-GCCATTC- CATTTTTTGAGAATCCAGAATTTGA-CGCAGA- GAAGAAGCAA) ... con- cluded that the activity of the tagged IN was undistin- guishable from that of the parental protein. Biotinylation and capture of IN...

Ngày tải lên: 12/08/2014, 23:23

... failure and epinephrine dosage during cardiopulmonary resuscitation was found [17]. This may indi- cate that the extent of hypoxia/ischemia may also play a role in the development of AKI. In fact, acute ... levels indicating hypoxic brain damage was observed. Our data show that changes in serum creatinine may contribute to the prediction of outcome in patients with car...

Ngày tải lên: 13/08/2014, 19:20

... higher measurements reflecting better quality. Areas of the array with obvious blemishes were automatically given a low quality value. Statistical analysis of cDNA microarray data Normalized log ... pancreas, lung, and normal lactating mammary gland of FVB mice of 6 months of age. All reference RNA used in this study is from a single preparation. cDNA microarray hybridizatio...

Ngày tải lên: 14/08/2014, 14:22

... 6 . In these conditions, several pathological changes of the pla- centa can be seen. Ischemic changes of the placenta include an increase of avascular villi, syncytial knots, and an immature ... T, Kameyama K, Susumu N, Nakamura M, Iwata T, Aoki D. Abdominal radical trachelectomy as a fertili- ty-sparing procedure in women with early-stage cervical cancer in a ser...

Ngày tải lên: 25/10/2012, 11:48