... attempt was markedly below the recommendations given in national standards. Systems at the hospital level for the management and care of patients admitted after a suicide attempt and systematic ... manuscript. Acknowledgements The study was supported by a grant from the Directorate of Health and Social Affairs, Norway. Mork et al. Annals of General Psychiatry 2010...
Ngày tải lên: 08/08/2014, 23:21
... Huntsville, AL USA). The primer sequences used were: for β-actin, for- ward CCTTCGTGCCCCCCC and reverse GGAGAC- CAAAAGCCTTCATACATC; and for HMGB1, forward ATTGGTGATGTTGCGAAGAA and reverse GATCCACAG- CAACTCCAGAA. ... all patients and the study was approved by the local ethical committee at Karolinska University Hospital, Stockholm, Sweden. The median age of patients was...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: " An open letter to George M Philip, President of the State University of New York At Al" potx
... enlightening. Your classics faculty would gladly tell you about them, if only you had a Classics department, which now, of course, you don’t. As for the argument that the humanities don’t pay their ... virology programs. My second example you will probably be more familiar with. Middle Eastern Studies, including the study of foreign languages such as Arabic and Persia...
Ngày tải lên: 09/08/2014, 22:23
Báo cáo y học: "Human immunodeficiency virus infection and autoimmune hepatitis during highly active anti-retroviral treatment: a case report and review of the literature" potx
... informed consent was obtained from the patient for publicatio n of this case report and any accompany- ing images. A copy of the written consent is available for review by the Editor-in-Chief of ... office with fever and tachycardia and was hos- pitalized because of possible sepsis and acute abdomen. Her physical examination revealed that she was febrile (body temp...
Ngày tải lên: 10/08/2014, 23:21
Báo cáo y học: " Renal cell carcinoma metastasizing to solitary fibrous tumor of the pleura: a case report" ppt
... spinal radiation therapy and gamma knife radiosurgery for brain metastasis. With metastatic disease causing increased morbidity and no further treatment options available, t he patient was placed ... alternating hypercellular and hypocellular areas and characteristic branching, staghorn vessels which may captivate blood- borne metastases, as in the case of renal cell carcinoma...
Ngày tải lên: 10/08/2014, 23:21
Báo cáo y học: "Patent abdominal subcutaneous veins caused by congenital absence of the inferior vena cava: a case report" pptx
... vena cava (IVC) are rare. Patients are usually asymptomatic and this developmental anomaly is detected incidentally dur- ing abdominal surgery or radiologic e valuation. Patent paraumbilical and ... subcardina l, and supracardinal veins. A normal IVC is composed of four segments which are hepatic, suprarenal, renal and infrare- nal. Variation s of IVC anatomy are classified in...
Ngày tải lên: 11/08/2014, 03:20
Báo cáo y học: "Patent abdominal subcutaneous veins caused by congenital absence of the inferior vena cava: a case report" potx
... Medicine, Heinrichstrasse 3 1a, A- 8010 Graz, Austria. Authors’ contributions WJS and RWL conceived of and designed the study. WJS and PR analyzed and interpreted the data. WJS drafted the article and, along ... collateral veins are variable and, due to inadequate collateral circulation, this results in venous stasis and an increased risk of DVT. Congenital anomalies o...
Ngày tải lên: 11/08/2014, 06:23
Báo cáo y học: "Proteinase-activated receptor-2: two potential inflammatory mediators of the gastrointestinal tract in Atlantic salmon" ppt
... 1316* PAR- 2a - PAR- 2a_ RACE_R1 TGGACTCCCCTGAAGATTGCCTACCAC 739* PAR-2b - PAR-2b_RACE_F1 CTGGACACCTCTGAAGATCGCCTACCAC 1655* PAR-2b - PAR-2b_RACE_R1 GCCCACCAGGACTTTACACAGCCT 687* PAR- 2a - PAR- 2a_ RT_F1 ... colonocytes is influenced by increased luminal proteinase activity rather than the release of proteinases such as tryptase [22]. Increased luminal trypsin-like activity in the d...
Ngày tải lên: 11/08/2014, 08:22
Báo cáo y học: " Facial herpes zoster infection precipitated by surgical manipulation of the trigeminal nerve during exploration of the posterior fossa: a case report" potx
... phenomenon, as well as the importance and role of prophylactic acyclovir in its management, are discussed. Case presentation: A 54-year-old Caucasian man with a classical long-standing left-sided V2 and ... fossa: a case report Nassir Mansour 1 , Chandrasekaran Kaliaperumal 2 * and Kishor A Choudhari 1 Addresses: 1 Department of Neurosurgery, Regional Neurosciences Uni...
Ngày tải lên: 11/08/2014, 14:20
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc
... monomers for polymeriza- tion may play a critical role in actin filament assembly in the actin patch. Binding of the LBD to Las17p may also stimulate Las17p-dependent activation of the Arp2 ⁄ 3 complex. ... actin-filament assembly in yeast cells. It has also recently been shown that human WASP–WIP interaction is essential for human WASP to function- ally substitute for yeast W...
Ngày tải lên: 18/02/2014, 16:20