Báo cáo y học: "Impact of attention-deficit/hyperactivity disorder on the patient and family: results from a European survey" ppsx
Báo cáo y học: "Impact of attention-deficit/hyperactivity disorder on the patient and family: results from a European survey" ppsx
... terms of the impact of their condition on eve-
ryday activities, general behaviour and family relation-
ships, and the times of day reported by their parents as
challenging. This may be due to the ... relationships, as assessed by par-
ents. A secondary aim of the survey was to investigate the
parental assessment of the effect of stimulant medication
on the...
Báo cáo y học: "Impact of methylphenidate formulation on treatment patterns and hospitalizations: a retrospective analysis" pptx
... than 17 million managed-care lives. Labo-
ratory results, hospitalization data, pharmacy data, and
complete mental health data are available from this data-
base, in addition to patient demographics. ... Specialty Pharmaceuticals.
Authors' contributions
JK and ML conceptualized and designed the study. ML
had primary responsibility for analysis of and interpreta-
tion of...
Báo cáo y học: "impact of oral melatonin on the electroretinogram cone respons" pps
... statistical analy-
sis.
KVD collected the data, contributed to the design of the
study and to the statistical analysis.
SGR contributed to the interpretation of the results and
the final revision of the ... that oral
melatonin administration induces a significant decrease
of the maximal cone response as well as a decrease of the
sum of OPs. The impa...
Báo cáo y học: "Impact of bile acids on the growth of human cholangiocarcinoma via FXR" ppt
... preparation. JQD, YD and YXZ
conducted experiments, data acquisition and interpretation of data. YHS and
HXW were involved in the analysis and interpretation of data as well as
manuscript preparation. ... -CAGAATGCCCAGACG-
GAAG-3’ . b-actin’ sforward5’ -TTGCTGAT CCA
CATCTGCT- 3’ reverse 5’-GACAGGATGCAGAAGGA-
GAT-3’ .GAPDHwasusedasaninternalcontrolfor
RT-PCR and b-actin was use...
Báo cáo y học: " Impact of nosocomial pneumonia on the outcome of mechanically-ventilated patient pps
... Cardiogenic and non-cardiogenic
pulmonary edema was diagnosed by pulmonary arterial
catheterization and response to appropriate therapy. Multi-
ple organ failure (MOF) was defined according to the crite-
ria ... empir-
ical therapy has a great impact on survival. Early and appro-
priate therapy could explain the discrepancy between our
findings and those of other investigato...
Báo cáo y học: "Impact of interleukin-6 on hypoxia-induced pulmonary hypertension and lung inflammation in mice" ppt
... 5'-3' Reverse 5'-3'
IL-6 mouse CTCTGGGAAATCGTGGAAATG AAGTGCATCATCGTTGTTCATACA
IL-6R mouse GACTATTTATGCTCCCTGAATGATCA ACTCACAGATGGCGTTGACAAG
gp-130 mouse CAATTTTGACCCCGTGGATAA GATAATTCTTCTGAGTTGGTCACTGA
MCP-1 ... T, Nagaya N, Ishibashi-Ueda H, Kyotani S, Oya H, Sakamaki F,
Kimura H, Nakanishi N: Increased plasma monocyte chemoat-
tractant protein-1 level in idiopathic pulmo...
Báo cáo y học: "Impact of renal dysfunction on weaning from prolonged mechanical ventilation" potx
... disposit ion (only one of the 10 dis-
charged patients went home) and short survival imply a
very low functional capacity and quality of life.
It is possible that improvement in survival can be
achieved ... uniforml y
poor, as it w as for all groups. Of the 10 patients dis-
charged alive, the longest survival was only 22 days.
Although functional status was not specificall...
Báo cáo y học: "Impact of intensive care on renal function before graft harvest: results of a monocentric study" pot
... influence the quality of kidney grafts transplanted if
the hemodynamic condition of the donor is maintained [20].
However, the link between the quality of kidney graft and the
ICU length of stay appears ... ICU admission and organ harvest. The
quantitative variables were assessed by a Student's t test or
an analysis of variance. For the qualitative variabl...
Báo cáo y học: "Impact of emergency intubation on central venous oxygen saturation in critically ill patients: a multicenter observational study" potx
... oxygen saturation and arterial oxygen saturation after intubation. SaO
2
= arterial oxygen saturation;
ScvO
2
= central venous oxygen saturation.
Critical Care Vol 13 No 3 Hernandez et al.
Page ... sub-
groups, regardless of the cause of intubation and baseline
arterial oxygen saturation. In contrast, the effects on oxygen
extraction were more variable. In almost 30% of th...
Báo cáo y học: "Management of chest pain: exploring the views and experiences of chiropractors and medical practitioners in a focus group interview"
... depend on the nature of the condition and
the urgency of the situation, that the point of referral may
depend on the familiarity or relationship between the
providers, and that the nature of the ... pain as a
chronic, multifactorial, or comorbid condition; (4) Inter-
professional coordination of care; (5) Best practices and
standardization of care; a...
Từ khóa:
- the impact of capital market on the growth and development of nigerian economy
- impact of mtbe phaseout on the petroleum and petrochemical industries
- báo cáo y học
- báo cáo y học
- báo cáo y học cổ truyền
- mẫu báo cáo y học cổ truyền
- bao cao y hoc colchicin
- phan ban luan trong bao cao y hoc co truyen
- báo cáo khoa học ảnh hưởng của việc thay thế cỏ xanh trong khẩu phần bằng bã dứa ủ chua đến khả năng sản xuất của bò thịt pot