Báo cáo y học: "Impact of attention-deficit/hyperactivity disorder on the patient and family: results from a European survey" ppsx

Báo cáo y học: "Impact of attention-deficit/hyperactivity disorder on the patient and family: results from a European survey" ppsx

Báo cáo y học: "Impact of attention-deficit/hyperactivity disorder on the patient and family: results from a European survey" ppsx

... terms of the impact of their condition on eve- ryday activities, general behaviour and family relation- ships, and the times of day reported by their parents as challenging. This may be due to the ... relationships, as assessed by par- ents. A secondary aim of the survey was to investigate the parental assessment of the effect of stimulant medication on the...

Ngày tải lên: 13/08/2014, 18:21

15 368 0
Báo cáo y học: "Impact of methylphenidate formulation on treatment patterns and hospitalizations: a retrospective analysis" pptx

Báo cáo y học: "Impact of methylphenidate formulation on treatment patterns and hospitalizations: a retrospective analysis" pptx

... than 17 million managed-care lives. Labo- ratory results, hospitalization data, pharmacy data, and complete mental health data are available from this data- base, in addition to patient demographics. ... Specialty Pharmaceuticals. Authors' contributions JK and ML conceptualized and designed the study. ML had primary responsibility for analysis of and interpreta- tion of...

Ngày tải lên: 08/08/2014, 21:20

8 385 0
Báo cáo y học: "impact of oral melatonin on the electroretinogram cone respons" pps

Báo cáo y học: "impact of oral melatonin on the electroretinogram cone respons" pps

... statistical analy- sis. KVD collected the data, contributed to the design of the study and to the statistical analysis. SGR contributed to the interpretation of the results and the final revision of the ... that oral melatonin administration induces a significant decrease of the maximal cone response as well as a decrease of the sum of OPs. The impa...

Ngày tải lên: 10/08/2014, 09:20

7 335 0
Báo cáo y học: "Impact of bile acids on the growth of human cholangiocarcinoma via FXR" ppt

Báo cáo y học: "Impact of bile acids on the growth of human cholangiocarcinoma via FXR" ppt

... preparation. JQD, YD and YXZ conducted experiments, data acquisition and interpretation of data. YHS and HXW were involved in the analysis and interpretation of data as well as manuscript preparation. ... -CAGAATGCCCAGACG- GAAG-3’ . b-actin’ sforward5’ -TTGCTGAT CCA CATCTGCT- 3’ reverse 5’-GACAGGATGCAGAAGGA- GAT-3’ .GAPDHwasusedasaninternalcontrolfor RT-PCR and b-actin was use...

Ngày tải lên: 10/08/2014, 21:23

8 361 0
Báo cáo y học: " Impact of nosocomial pneumonia on the outcome of mechanically-ventilated patient pps

Báo cáo y học: " Impact of nosocomial pneumonia on the outcome of mechanically-ventilated patient pps

... Cardiogenic and non-cardiogenic pulmonary edema was diagnosed by pulmonary arterial catheterization and response to appropriate therapy. Multi- ple organ failure (MOF) was defined according to the crite- ria ... empir- ical therapy has a great impact on survival. Early and appro- priate therapy could explain the discrepancy between our findings and those of other investigato...

Ngày tải lên: 12/08/2014, 18:20

6 354 0
Báo cáo y học: "Impact of interleukin-6 on hypoxia-induced pulmonary hypertension and lung inflammation in mice" ppt

Báo cáo y học: "Impact of interleukin-6 on hypoxia-induced pulmonary hypertension and lung inflammation in mice" ppt

... 5'-3' Reverse 5'-3' IL-6 mouse CTCTGGGAAATCGTGGAAATG AAGTGCATCATCGTTGTTCATACA IL-6R mouse GACTATTTATGCTCCCTGAATGATCA ACTCACAGATGGCGTTGACAAG gp-130 mouse CAATTTTGACCCCGTGGATAA GATAATTCTTCTGAGTTGGTCACTGA MCP-1 ... T, Nagaya N, Ishibashi-Ueda H, Kyotani S, Oya H, Sakamaki F, Kimura H, Nakanishi N: Increased plasma monocyte chemoat- tractant protein-1 level in idiopathic pulmo...

Ngày tải lên: 12/08/2014, 14:20

13 307 0
Báo cáo y học: "Impact of renal dysfunction on weaning from prolonged mechanical ventilation" potx

Báo cáo y học: "Impact of renal dysfunction on weaning from prolonged mechanical ventilation" potx

... disposit ion (only one of the 10 dis- charged patients went home) and short survival imply a very low functional capacity and quality of life. It is possible that improvement in survival can be achieved ... uniforml y poor, as it w as for all groups. Of the 10 patients dis- charged alive, the longest survival was only 22 days. Although functional status was not specificall...

Ngày tải lên: 12/08/2014, 18:20

5 391 0
Báo cáo y học: "Impact of intensive care on renal function before graft harvest: results of a monocentric study" pot

Báo cáo y học: "Impact of intensive care on renal function before graft harvest: results of a monocentric study" pot

... influence the quality of kidney grafts transplanted if the hemodynamic condition of the donor is maintained [20]. However, the link between the quality of kidney graft and the ICU length of stay appears ... ICU admission and organ harvest. The quantitative variables were assessed by a Student's t test or an analysis of variance. For the qualitative variabl...

Ngày tải lên: 13/08/2014, 08:20

9 342 0
Báo cáo y học: "Impact of emergency intubation on central venous oxygen saturation in critically ill patients: a multicenter observational study" potx

Báo cáo y học: "Impact of emergency intubation on central venous oxygen saturation in critically ill patients: a multicenter observational study" potx

... oxygen saturation and arterial oxygen saturation after intubation. SaO 2 = arterial oxygen saturation; ScvO 2 = central venous oxygen saturation. Critical Care Vol 13 No 3 Hernandez et al. Page ... sub- groups, regardless of the cause of intubation and baseline arterial oxygen saturation. In contrast, the effects on oxygen extraction were more variable. In almost 30% of th...

Ngày tải lên: 13/08/2014, 16:20

6 284 0
Báo cáo y học: "Management of chest pain: exploring the views and experiences of chiropractors and medical practitioners in a focus group interview"

Báo cáo y học: "Management of chest pain: exploring the views and experiences of chiropractors and medical practitioners in a focus group interview"

... depend on the nature of the condition and the urgency of the situation, that the point of referral may depend on the familiarity or relationship between the providers, and that the nature of the ... pain as a chronic, multifactorial, or comorbid condition; (4) Inter- professional coordination of care; (5) Best practices and standardization of care; a...

Ngày tải lên: 25/10/2012, 10:06

10 789 0
w