Báo cáo y học: " The NICE ADHD health technology assessment: A review and critique" doc
Báo cáo y học: " The NICE ADHD health technology assessment: A review and critique" doc
... the >600-page technology assessment report, which aimed at evaluating ADHD treatment strategies by a clinical effectiveness review and an economic analysis using meta-analytical techniques and a cost-effectiveness ... tech- nology appraisals are already being used as international benchmarks" [2], beyond NICE& apos;s primary remit to pro- vide guidance for the Natio...
Ngày tải lên: 13/08/2014, 18:21
Báo cáo y học: "The loss of health status in rheumatoid arthritis and the effect of biologic therapy: a longitudinal observational study" pot
... a substantial disconnect between damage and health status, and that pain and difficulty and uncertainty, the burden of RA, may impact measured self-reported health status more than damage. Conclusions RA ... (below) at time 0. Annual cost is the annual cost calculated for the 10-year duration before and the 10-year duration after the start of biologic therapy. HAQ,...
Ngày tải lên: 12/08/2014, 11:23
Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc
... ACGTTGGATGAGAGAACTGGGTTAAGGCAG rev ACGTTGGATGCCAGCACATCTTTTCACTCC ACTCCATACCACTGGTCAGCTG 93.81 ST+7 rs574174 G /A 0.19 0.19 fwd ACGTTGGATGCTGCCCTTGATGATTCCAAG rev ACGTTGGATGGGAACATCACAGGAAATGAC ACTGTCCCCATCCCATC ... ACGTTGGATGTTGCTCAGCCCCAAAGATGG CCCCACAGCCACTGGACAG 93.95 V4 rs2787094 C/G 0.22 0.23 fwd ACGTTGGATGAGAAACAGGAAGGAAGGTCC rev ACGTTGGATGTATGGTTCGACTGAGTCCAC CTGAGTCCACACTCCCCTG 93.8...
Ngày tải lên: 12/08/2014, 16:20
Báo cáo y học: " The necessary future of chiropractic education: a North American perspective" doc
... educational system must adopt the tenets of the academy: scientific thinking, rigor and critical analysis. Faculty in the academy have the dual duties of being teachers and scholars. Scholarship ... essential history of chiropractic education, including an overview of educational standards, curricula, externship and postgraduate training programs, along with evidence-based heal...
Ngày tải lên: 13/08/2014, 13:22
Báo cáo y học: "The epidemiology of intensive care unit-acquired hyponatraemia and hypernatraemia in medical-surgical intensive care unit"
... data and revised the manuscript. RS acquired data and revised the manuscript. KL acquired data, interpreted data and revised the manuscript. HTS and FK had full access to all the study data and ... ICU-acquired hyponatraemia and hypernatraemia varies according to patient characteris- tics. • ICU-acquired hyponatraemia and hypernatraemia are associated with increased ri...
Ngày tải lên: 25/10/2012, 10:31
Báo cáo Y học: The folding of dimeric cytoplasmic malate dehydrogenase Equilibrium and kinetic studies doc
... Sanyal et al. (Eur. J. Biochem. 269) Ó FEBS 2002 The folding of dimeric cytoplasmic malate dehydrogenase Equilibrium and kinetic studies Suparna C. Sanyal 1 , Debasish Bhattacharyya 2 and Chanchal ... glutaraldehyde and subsequent analysis of the cross-linked material by SDS/PAGE allows identification and relative quantitation of the different intermediate species reflecting the...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo Y học: The role of arginine residues in substrate binding and catalysis by deacetoxycephalosporin C synthase potx
... compared to the wild- type enzyme. Enzyme assays Wild-type DAOCS and all mutants were assayed for their ability to convert 2-oxoglutarate to succinate and carbon dioxide [17], and penicillin N and ... the precise arrangement of the ligands around the iron is uncertain [12]. Correspondence to M. D. Lloyd, The Department of Pharmacy and Pharmacology, The University of Bath...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo Y học: The effect of amino-acid substitutions I112P, D147E and K152N in CYP11B2 on the catalytic activities of the enzyme pdf
... Mitsuuchi. Y. , Toda, K., Miyahara, K., Yokoyama, Y. , Nakao, K., Hosoda, K., Y amamoto, Y. , I mura, H. & Shizuta, Y. (1990) Cloning of cDNA and genomic DNA for human c ytochrome P-45011 beta. FEBS ... differ between the human CYP11B1 and CYP11B2 enzyme, and are c and idate residues for influencing the enzymatic activity of human aldosterone synthase. As the two helice...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo y học: "The STRS (shortness of breath, tremulousness, racing heart, and sweating): A brief checklist for acute distress with panic-like autonomic indicators; development and factor structure" ppt
... Islands Health Care System, Spark M. Matsunaga Medical Center, Honolulu, HI, USA and 2 Department of Psychology, University of Hawaii at Manoa, Honolulu, HI, USA Email: HS Bracha* - H.Bracha@med.va.gov; ... eigenvalues greater than one. The sharp elbow in the scree-plot after the second factor and the attainment of minimum values of Akaike's informa- tion criterion (AIC)...
Ngày tải lên: 08/08/2014, 20:23
Báo cáo y học: "The abilities of improved schizophrenia patients to work and live independently in the community: a 10-year long-term outcome study from Mumbai, India" ppsx
... from Mumbai, India Amresh Kumar Srivastava* 1,5 , Larry Stitt 2 , Meghana Thakar 1 , Nilesh Shah 3 and Gurusamy Chinnasamy 4 Address: 1 Mental Health Foundation of India (PRERANA Charitable Trust) ... final manu- script. Acknowledgements The authors thank the PRERANA Charitable Trust, Mumbai, India for finan- cial support and the clinical and research staff, particularly Sange...
Ngày tải lên: 08/08/2014, 23:21