Báo cáo y học: " Utility of a single adjusting compartment: a novel methodology for whole body physiologically-based pharmacokinetic modelling" ppt
Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"
... quality assurance survey Natalie Chahine-Malus, Thomas Stewart, Stephen E Lapinsky, Ted Marras, David Dancey, Richard Leung and Sangeeta Mehta Mount Sinai Hospital, Toronto, Ontario, Canada Correspondence: ... other. Analysis Given that medical and surgical patients often have different complications and varying lengths of stay, the data for each were analyzed separately. Surgical patien...
Ngày tải lên: 25/10/2012, 10:45
Báo cáo y học: " Utility of a single adjusting compartment: a novel methodology for whole body physiologically-based pharmacokinetic modelling" ppt
... house data. . 37. Nakajima Y, Hattori K, Shinsei M, Matsunaga N, Iizasa H, Sasabe H, Akiyama H, Miyanmoto G, Nakashima E: Physiologically-based pharmacokinetic analysis of grepafloxacin. Biol Pharm ... 2003, April 3. 42. Nakata M, Yamashiro Y, Shimakura M, Takahata M, Minami S, Watan- abe Y, Narita H: Pharmacokinetics of pazufloxacin mesilate in experimental animals. Jpn J Chemothe...
Ngày tải lên: 13/08/2014, 16:21
Báo cáo y học: "Utility of a simplified ultrasound assessment to assess interstitial pulmonary fibrosis in connective tissue disorders - preliminary results" pptx
... conducted data evaluation and prepared the manuscript. FS participated in the statistical analysis and data evaluation and manuscript preparation. MC performed the HRCT exams, prepared the HRCT images, ... substantial input to the data evaluation and manuscript preparation. WG participated in the study development and gave substantial input to the data evaluation and manuscript preparation. A...
Ngày tải lên: 12/08/2014, 17:22
Báo cáo y học: "Replacement of cisplatin with nedaplatin in a definitive 5-fluorouracil/ cisplatin-based chemoradiotherapy in Japanese patients with esophageal squamous cell carcinoma"
... Naoko Chayahara 3 , Ikuya Miki 3 , Takao Tamura 3 , Tsubasa Inokuma 2 , Yoshiji Takemoto 2 , Tsutomu Nakamura 3 , Kazusaburo Kataoka 1 and Toshiyuki Sakaeda 2,3 1. School of Pharmacy ... H, Maki H, Takeda Y, et al. Evaluation of combined nedaplatin and docetaxel therapy for human head and neck cancer in vivo. Anticancer Res. 2006; 26: 989-94. 16. Yamashita H, Nakagawa...
Ngày tải lên: 26/10/2012, 09:53
Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc
... CCATGCCTATGATACTGGGAT-3¢ GSTM1-revA 5¢- CTAAAGATGAGACAGGCCTGG-3¢ GSTM1-revB 5¢-GATCCTAAAGATGAGACAGGCCTGG-3¢ GSTM2-forA 5¢-AATTCGATGCCTATGACACTGGGTTAC-3¢ GSTM2-forB 5¢- CGATGCCTATGACACTGGGTTAC-3¢ GSTM2-revA ... 4 AS-6 ACAAAGCATGATGAGCTGCA CDS 326–345 – 8 AS-7 GAGTA GAGCTTCATCTTCTC CDS 397–426 – 1 AS-8 ACTGGTCAAGAATGTCATAA CDS 480–499 – 7 AS-9 CAGGTTTGGGAAGGCGTCCA CDS 524–543 524–543 0 AS-10 CA...
Ngày tải lên: 31/03/2014, 15:20
Báo cáo y học: "Utility of the Framingham risk score to predict the presence of coronary atherosclerosis in patients with rheumatoid arthritis" pps
... unaware of the subjects' clinical status. Calculation of calcium scores The degree of coronary-artery calcification was calculated as described by Agatston et al. [16]. The area of each calcified plaque ... Tom- ographic imaging was electrocardiographically triggered at 60% of the interval between R waves. All areas of calcification within the borders of a coronary artery...
Ngày tải lên: 09/08/2014, 08:23
Báo cáo y học: "Utility of synovial biopsy" pps
... Kruithof E, De Rycke L, Vandooren B, Wyns B, Boullart L, Hoffman IEA, Boots AM, Veys EM, De Keyser F: Diagnostic classification of spondyloarthropathy and rheumatoid arthritis by synovial histopathology. ... C, Anract P, Hamadouche M, Ayral X, Dougados M, Gidrol X, Fournier C, Chiocchia G: DNA microarray allows molecular profiling of rheumatoid arthritis and identification of pathophysi...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: "Markers of inflammation and coagulation indicate a prothrombotic state in HIV-infected patients with long-term use of antiretroviral therapy with or without abacavir" pptx
... 7 of 7 9. Palella PGS, Elion R, Kaplan R, Williams C, Landay A, Jacobson L, Tracy R: Inflammatory markers among abacavir and non-abacavir recipients in the Womens' Interagency HIV Study ... values (interquartile range (IQR)) for not normally distributed variables and means (standard deviation) for normally Table 2: Results of laboratory parameters according to ABC use* Laborat...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: " Utility of clinical assessment, imaging, and cryptococcal antigen titer to predict AIDS-related complicated forms of cryptococcal meningitis" ppt
... predict AIDS-related complicated forms of cryptococcal meningitis Edward R Cachay 1* , Joseph Caperna 1 , Amy M Sitapati 1 , Hamta Jafari 2 , Sean Kandel 3 , William C Mathews 1 Abstract Background: ... Cryp- tococcal antigen availability and use are variable in developing countries [1]. Over the last twenty years at the University of California, San Diego (UCSD), we occasionally cared f...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Atrophy of the brachialis muscle after a displaced clavicle fracture in an Ironman triathlete: case report" docx
... subsequently to an atrophy of the brachialis muscle. Physicians should be aware of this potential com- plication and diagnostic imaging is a must in any type and gradeoffracturetoallowadiagnostic-based ... the available options, he asked for an intramedullary nail and the surgeon agreed. Post-surgi- cally, the pain disappeared initially, but it returned after a few days. An MRI scan...
Ngày tải lên: 10/08/2014, 10:20