Báo cáo y học: " Variance in multiplex suspension array assays: A distribution generation machine for multiplex counts" ppsx

Báo cáo y học: " Variance in multiplex suspension array assays: A distribution generation machine for multiplex counts" ppsx

Báo cáo y học: " Variance in multiplex suspension array assays: A distribution generation machine for multiplex counts" ppsx

... Medical Modelling Open Access Research Variance in multiplex suspension array assays: A distribution generation machine for multiplex counts Brian P Hanley 1,2 Address: 1 Microbiology Graduate ... However, intraplexing assays [3] can address the issue of counts per classifier variance and precision allowing multiplexed assays to work with relatively low values of n...

Ngày tải lên: 13/08/2014, 16:21

6 229 0
Báo cáo y học: " Variance in multiplex suspension array assays: microsphere size variation impact" ppt

Báo cáo y học: " Variance in multiplex suspension array assays: microsphere size variation impact" ppt

... C, Kettman J: Analysis of Individ- ual Data from Bead-Based Assays ("Bead Arrays"). Cytometry Part A 2006, 6 9A: 384-390. 5. Jacobsen JW: Conversation at xMap 2006 that carboxylation chemistry ... Central Page 1 of 8 (page number not for citation purposes) Theoretical Biology and Medical Modelling Open Access Research Variance in multiplex suspension array assays: m...

Ngày tải lên: 13/08/2014, 16:21

8 177 0
Báo cáo y học: "Variance in multiplex suspension array assays: intraplex method improves reliability" pps

Báo cáo y học: "Variance in multiplex suspension array assays: intraplex method improves reliability" pps

... Kettman J: Analysis of Individ- ual Data from Bead-Based Assays ("Bead Arrays"). Cytometry A 2006, 69(5):384-390. 9. Hanley B, Xing L, Cheng RH: Variance in multiplex suspension array assays: ... external mean, where an external mean is the mean of an assay for a different analyte. This graph demonstrates that, on average, an apparently quite stable external mea...

Ngày tải lên: 13/08/2014, 16:21

10 182 0
Báo cáo y học: " Involvement in the US criminal justice system and cost implications for persons treated for schizophrenia" pps

Báo cáo y học: " Involvement in the US criminal justice system and cost implications for persons treated for schizophrenia" pps

... baseline and again at 3 post-baseline assessments at 2, 8, and 12 months (endpoint). Measures Patients’ baseline sociodemographic and clinical charac- teristics were assessed using standard psychiatric ... [21], adjusted to 2001 dollars. Statistical analysis Analyses compared participants who reported no legal involvement with those reporting any involvement at baseline or at any o f the 3 po...

Ngày tải lên: 11/08/2014, 16:22

10 282 0
Báo cáo y học: "Change in serum KL-6 level from baseline is useful for predicting life-threatening EGFR-TKIs induced interstitial lung disease" pdf

Báo cáo y học: "Change in serum KL-6 level from baseline is useful for predicting life-threatening EGFR-TKIs induced interstitial lung disease" pdf

... Kobayashi K, Sugawara S, Oizumi S, Isobe H, Gemma A, Harada M, Yoshizawa H, Kinoshita I, Fujita Y, Okinaga S, Hirano H, Yoshimori K, Harada T, Ogura T, Ando M, Miyazawa H, Tanaka T, Saijo Y, Hagiwara ... Hotta K, Kiura K, Takigawa N, Yoshioka H, Harita S, Kuyama S, Yonei T, Fujiwara K, Maeda T, Aoe K, Ueoka H, Kamei H, Umemura S, Moritaka T, Segawa Y, Kawai H, Bessho A, Kato K, Tabata M,...

Ngày tải lên: 12/08/2014, 13:22

11 306 0
Báo cáo y học: "Agitation in the ICU: part one Anatomical and physiologic basis for the agitated state" ppt

Báo cáo y học: "Agitation in the ICU: part one Anatomical and physiologic basis for the agitated state" ppt

... 3 Table 1 Neurotransmission and chemical transmitters Cholinergic Biogenic Amino acid Acetylcholine Dopamine GABA Norepinephrine Glycine Serotonin Glutamate Histamine Aspartate GABA, γ-amino ... nocieceptors are inte- grated and relayed via integrated afferent pathways from the hypothalamus to the reticular activating system via the reticular formation, beginning in the medulla and extend-...

Ngày tải lên: 12/08/2014, 18:20

12 392 0
Báo cáo y học: "Endotoxemia in critically ill patients: why a reliable test could be beneficial" ppt

Báo cáo y học: "Endotoxemia in critically ill patients: why a reliable test could be beneficial" ppt

... potential to determine Gram-negative infections in critically ill patients. In addition, a reliable EAA may indicate the adequacy of gastrointestinal tract perfusion, as well as potentially help to predict ... endotoxemia may provide a clue to the cause of sepsis or may indicate translocation of endotoxin from the gastrointestinal tract. A reliable endotoxin activity assay (EAA) off...

Ngày tải lên: 12/08/2014, 18:21

3 297 0
Báo cáo y học: "Year in review 2005: Critical Care — Respirology: mechanical ventilation, infection, monitoring, and education" ppsx

Báo cáo y học: "Year in review 2005: Critical Care — Respirology: mechanical ventilation, infection, monitoring, and education" ppsx

... Gainnier M, Sainty JM, Auffray JP, Papazian L: Influence of support on intra-abdominal pressure, hepatic kinetics of indocyanine green and extravascular lung water during prone positioning in ... this was a limited study, a respiratory variation in pulse oximetry plethysmographic waveform amplitude above 15% accurately discriminated between patients with a respiratory variation in...

Ngày tải lên: 12/08/2014, 23:24

5 230 0
Báo cáo y học: " Low autocrine interferon beta production as a gene therapy approach for AIDS: Infusion of interferon beta-engineered lymphocytes in macaques chronically infected with SIVmac251" pot

Báo cáo y học: " Low autocrine interferon beta production as a gene therapy approach for AIDS: Infusion of interferon beta-engineered lymphocytes in macaques chronically infected with SIVmac251" pot

... two external gag-specific primers (1386-5': GAAACTAT- GCCAAAAACAAGT and 2129-5': TAATCTAGCCTTCT- GTCCTGG) and two internal gag-specific primers (1731N 5': CCGTCAGGATCAGATATTGCAGGAA and 2042C ... publication of this paper in the past five years. The authors never any stocks or shares in an organization that may in any way gain or lose finan- cially from the publication of...

Ngày tải lên: 13/08/2014, 13:20

11 256 0
Báo cáo y học: "Improvement in hearing after chiropractic care: a case series" pps

Báo cáo y học: "Improvement in hearing after chiropractic care: a case series" pps

... alerting system activating a mosaic of specific discrete cortical areas appropriate to a particular task and maintaining other cortical areas in a state of rel- ative disengagement (inhibition). Asymmetric ... unimodal association areas in turn project to multimodal sensory association areas that integrate infor- mation about more than one sensory modality. Animal experiments indica...

Ngày tải lên: 13/08/2014, 14:20

7 215 0
Từ khóa:
w