... probably because of the relatively greater blood flow to that area [1]. Among women, the primary s ites for choroidal metastasis are the breast, lung, unknown primary, gastrointestinal and pancreas, ... 58% had lung cancer and 28% had breast ca ncer [5]. Differential diagnosis of choroidal metastasis includes choroidal melanoma, chor- oidal osteoma, choroidal hemangioma, choroidal neovas...
Ngày tải lên: 11/08/2014, 12:20
... severity of respiratory disease symptoms and improving patient's quality of life [6,7]. Alternative medicines, particularly plant extracts have shown acceptance by patients and physicians alike ... sub-saharan Africa. Allergy 2003, 58:265-283. 6. Bielory LB, Lupoli K: Herbal intervention in asthma and allergy. J Asthma 1999, 36:1-65. 7. Markham AW, Wilkinson JM: Complimentary and alterna...
Ngày tải lên: 13/08/2014, 13:22
Báo cáo y học: " Simulating non-small cell lung cancer with a multiscale agent-based model" doc
... purposes) metastatic variant of a human non-small- cell lung cancer cell line. Br J Cancer 1996, 74:1776-1782. 52. Kurachi H, Morishige K, Amemiya K, Adachi H, Hirota K, Miyake A, Tanizawa O: Importance ... General Hospital, Charlestown, MA 02129, USA Email: Zhihui Wang - billwang@nmr.mgh.harvard.edu; Le Zhang - adamzhan@nmr.mgh.harvard.edu; Jonathan Sagotsky - sagotsky@nmr.m...
Ngày tải lên: 13/08/2014, 16:21
Báo cáo y học: " High avidity autoreactive T cells with a low signalling capacity through the T-cell receptor: central to rheumatoid arthritis pathogenesis" pot
... Kitamura H, Iwakabe K, Yahata T, Nishimura S, Ohta A, Ohmi Y, Sato M, Takeda K, Okumura K, Van Kaer L, Kawano T, Taniguchi M, Nishimura T: The natural killer T (NKT) cell ligand alpha- galactosylceramide ... 7:1092- 1100. 8. Yoshitomi H, Sakaguchi N, Kobayashi K, Brown GD, Tagami T, Sakihama T, Hirota K, Tanaka S, Nomura T, Miki I, Gordon S, Akira S, Nakamura T, Sakaguchi S: A role for...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: " Adult granulosa cell tumor associated with endometrial carcinoma: a case report" pps
... history of a similar illness. She had attained menarche a t the age of 15 years, and her coitarche occurred at age 16 yea rs. She had not had any Papanicolao u smears in the past. She was not ... demon- strated by a choriocarc inoma or yolk sac tumor. How- ever, they can also produce other placental hormones, such as placental alkaline phosphatase and lactate dehy- drogenase [7]. Granul...
Ngày tải lên: 10/08/2014, 23:22
Báo cáo y học: " Occult renal cell carcinoma manifesting with epistaxis in a woman: a case report" doc
... tumor. Nasal malignant tumors are usually primary and account for 0.3% of all neoplasms and 3% of all head and neck neoplasms [1]. Occasionally metastatic sinonasal tumors from infraclavicular si ... lungs, brain, liver, adrenal glands and bones [6]. Supraclavicular metastases usua lly occur in the thyroid gland, brain and very rarely the nose and pa ranasal sinuses. RCC tumor cells spread to...
Ngày tải lên: 11/08/2014, 00:22
Báo cáo y học: " Extragonadal germ cell tumor presenting in a woman with systemic lupus erythematosus: a case report" ppt
... pituitary gland is a very rare occurrence. This case report describes a 28-year-old Malaysi an Malay woman with lupus nephritis who com- plained of headache and blurring of vision. She was later found ... C Yuen, Rashidi Saidin, Norella Kong Abstract Introduction: Germ cell tumor of the pituitary gland is a very rare occurrence. Case presentation: We describe the case of a 28-year...
Ngày tải lên: 11/08/2014, 12:20
Báo cáo y học: " Esophageal squamous cell carcinoma presenting with extensive skin lesions: a case report" docx
... 51-year-old man. Case presentation A 51-year-old man was admitted to our department with a four-week history of dysphagia, weight loss and nausea. He had a medical history of multiple sclerosis since April 2004 ... cutaneous metastases from melanoma and carcinoma [9]. In this study, tumor registry data from 7,608 patients was evalu- ated; 4,020 of these patients had metastatic disease...
Ngày tải lên: 11/08/2014, 23:21
Báo cáo y học: "Expression and reactivation of HIV in a chemokine induced model of HIV latency in primary resting CD4+ T cell" potx
... (suha.saleh@monash.edu) Fiona Wightman (fiona.wightman@monash.edu) Saumya Ramanayake (saumya1025@gmail.com) Marina Alexander (marina.r.alexander@gmail.com) Nitasha Kumar (nakum1@student.monash.edu) Gabriela ... 3' SL38 MS RNA beacon 5' GGGCCT TCTCTATCAAAGCAACCCACCTCC AGGCCC -3' 0dp 2137 Universal forward 5' CGCACGGCAAGAGGCAGG-3' 0dp 2138 US reverse 5' CCCGCTTA...
Ngày tải lên: 13/08/2014, 01:21
Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc
... CCATGCCTATGATACTGGGAT-3¢ GSTM1-revA 5¢- CTAAAGATGAGACAGGCCTGG-3¢ GSTM1-revB 5¢-GATCCTAAAGATGAGACAGGCCTGG-3¢ GSTM2-forA 5¢-AATTCGATGCCTATGACACTGGGTTAC-3¢ GSTM2-forB 5¢- CGATGCCTATGACACTGGGTTAC-3¢ GSTM2-revA ... GAAGTCCAGGCCCAGTTTGA CDS 152–171 152–171 0 AS-4 TCAATTAAGTAGGGCAGATT CDS 175–194 175–194 0 AS-5 TCTCCA AAACGTCCACACGA CDS – 285–304 4 AS-6 ACAAAGCATGATGAGCTGCA CDS 326–345 – 8 AS-7 GAGT...
Ngày tải lên: 31/03/2014, 15:20