Báo cáo y học: "Unfractionated heparin and enoxaparin reduce high-stretch ventilation augmented lung injury: a prospective, controlled animal experiment" potx
Báo cáo y học: "Unfractionated heparin and enoxaparin reduce high-stretch ventilation augmented lung injury: a prospective, controlled animal experiment" potx
... 1 Unfractionated heparin and enoxaparin reduced lung stretch–induced microvascular leak, lung edema, and total lung injuryUnfractionated heparin and enoxaparin reduced lung stretch-induced microvascular ... systemic abnormalities of coagulation and fibrinolysis may be an important therapeutic target over the local pulmonary abnormalities. In a previous human study, A...
Ngày tải lên: 13/08/2014, 16:21
Báo cáo y học: "Early biomarkers and potential mediators of ventilation-induced lung injury in very preterm lambs" ppt
... NM_001009465 353–473 CGATGAGCTTCTGTGTGATG CTGTGAGAGGAGGTGGAGAG IL-6 NM_001009392 598–705 CGCAAAGGTTATCATCATCC CCCAGGAACTACCACAATCA IL-8 NM_001009401 438–520 CCTCAGTAAAGATGCCAATGA TGACAACCCTACACCAGACC 18S X01117 1495–1673 ... DQ239634 444–532 AGGGTCACTGTGGAAGGTC GCAGCTGAAGTCAAAGGAA CTGF DQ239672 407–469 TATAGCTCCAGCGACAGCTC ACGAACTTGACTCAGCCTCA CYR61 DQ239628 286–354 ATCGTCCAAACAACTTCGTG GGTAA...
Ngày tải lên: 12/08/2014, 14:20
Báo cáo y học: "Serine/threonine kinase-protein kinase B and extracellular signal-regulated kinase regulate ventilator-induced pulmonary fibrosis after bleomycin-induced acute lung injury: a prospective, controlled animal experiment" pptx
... 5'- CAGACGGCTGAGTAGGGAACA-3'; type III procollagen, forward primer 5'-GGAAAGGATGGAGAGTCAGGAA-3' and reverse primer 5'-CATTGCGTCCATCAAAGCCT-3'; and GAPDH (internal control), forward ... 33:1913-1921. 27. Yaekashiwa M, Nakayama S, Ohnuma K, Sakai T, Abe T, Satoh K, Matsumoto K, Nakamura T, Takahashi T, Nukiwa T: Simultaneous or delayed administration of hepatoc...
Ngày tải lên: 13/08/2014, 11:22
Báo cáo y học: "Controlling Osteogenesis and Adipogenesis of Mesenchymal Stromal Cells by Regulating A Circadian Clock Protein with Laser Irradiation" pptx
... Engineering, Osaka University, 2-1 Yamadaoka, Suita, Osaka, 565-0871, Japan 2. PRESTO, Japan Science and Technology Agency, 4-1-8 Honcho Kawaguchi, Saitama, 332-0012, Japan 3. Division of Sustainable ... was evaluated by von Kossa staining (magnification: x50). At 5 days after treatment, staining increased with increased laser en- ergy. The area expressing alkaline phosphatase (ALP) act...
Ngày tải lên: 08/08/2014, 17:20
Báo cáo y học: "Dermal reaction and bigeminal premature ventricular contractions due to neostigmine: a case repor" pdf
... patient under general anesthesia. The drug is also used in patients with myasthenia gravis and paraly- tic ileus [1-3]. Increased saliva, nausea and v omiting, abdominal cramps, cardiac dysrhythmia ... Yousefshahi 1* , Mohammad Anbarafshan 2 , Patricia Khashayar 3 Abstract Introduction: Neostigmine is a frequently used acetylcholinesterase inhibitor administered to reverse muscular rela...
Ngày tải lên: 11/08/2014, 00:22
Báo cáo y học: "Severe heparin-induced thrombocytopenia: when the obvious is not obvious, a case report" pptx
... report Graham M Cormack and Larry J Kaufman* Address: Department of Medicine, University of Hawaii, and St. Francis Medical Center, Honolulu, HI, USA Email: Graham M Cormack - grahamcormack@hotmail.com; ... HIT may occur in up to 30% of patients Gangrenous right hand and left foot as they appeared on hospital day #15Figure 1 Gangrenous right hand and left foot as they appeared on hosp...
Ngày tải lên: 11/08/2014, 10:22
Báo cáo y học: "Epidural lipomatosis and congenital small spinal canal in spinal anaesthesia: a case report and review of the literature" pps
... patient's case illustrates that a small dural sac second- ary to an increased content of epidural fat and/ or a con- genital small spinal bony canal may be a potentially dangerous combination ... via direct needle trauma. An abnormal anatomy caused by epidural lipomatosis and/ or small spi- nal canal, a reduced CSF volume, which can also occur in pregnancy due to increased intr...
Ngày tải lên: 11/08/2014, 17:21
Báo cáo y học: " Prevalence, correlates and pattern of hepatitis B surface antigen in a low resource setting" doc
... CL, Nnatu SN, Anyiwo CE, Agbonlahor DE, Esumeh FI, Karpas A: A comparison of HIV seropositivity and Hepatitis B surface antigenemia (HBsAg) among the same group of apparently healthy pregnant women in ... and treatment program - past, present and future. Journal of Gastroenterology and Hepatology 2004, , 19: 1-4. 4. Elsheikh RM, Daak AA, Elsheikh MA, Karsany MS, Adam I: Hepatitis B...
Ngày tải lên: 11/08/2014, 21:21
Báo cáo y học: "Vertebral osteomyelitis and native valve endocarditis due to Staphylococcus simulans: a case report" pps
... human skin [4]. It is a common animal pathogen and is usually acquired from cattle, sheep and other domestic animals [4-6]. Anecdotal reports have associated S. simulans with bacteremia, native valve ... Clinical Laboratory Standards. Wayne, Pa; 2004. 4. Kloos WE, Bannerman TL: Staphylococcus and micrococcus. In Manual of Clinical Microbiology 7th edition. Edited by: Murray PR, Bar...
Ngày tải lên: 11/08/2014, 23:21
Báo cáo y học: "Involvement of Akt and endothelial nitric oxide synthase in ventilation-induced neutrophil infiltration: a prospective, controlled animal experiment" docx
... Medical School, an Associated Physician at Massachusetts General Hospital, and an employee of Novartis Pharmaceuticals. Novartis Pharmaceuticals was otherwise not involved in this research and ... Respiratory Therapy, Chang Gung Memorial Hospital, Kweishan, Taoyuan 333, Taiwan 3 Graduate Institute of Clinical Medical Sciences, Chang Gung University, Kweishan, Taoyuan 333, Taiwan 4 Pulmona...
Ngày tải lên: 13/08/2014, 08:20