Báo cáo y học: "Results from the national sepsis practice survey: predictions about mortality and morbidity and recommendations for limitation of care orders" docx

... the bone marrow and the gastrointestinal tissues from the cytotoxicity of CY in mice. We also profiled the changes of the expression of growth factors in gastric tissues in response to the damage ... sinensis protect bone marrow and gastrointestinal tissues against the cytotoxicity of cyclophosphamide in mice Marco K. C....

Ngày tải lên: 02/11/2012, 10:19

... for the biosynthesis of other clavams [13,14]. Thus, only functions for the gene products of orfs2–5 in the early stages of the pathway and the final stage (orf 9) of the clavulanic acid gene cluster ... clavuligerus .The orf6 gene of the clavulanic acid biosynthetic gene cluster in S. clavuligerus encodes a protein that shows sequence homolog...

Ngày tải lên: 08/03/2014, 22:20

... 2002 Homopolymeric M-type T. bernacchii ferritin (Eur. J. Biochem. 269) 1603 Ferritin from the spleen of the Antarctic teleost Trematomus bernacchii is an M-type homopolymer Guiseppina Mignogna 1 , ... Fanelli’, University of Rome ‘La Sapienza’, Italy Ferritin from the spleen of the Antarctic teleost Trematomus bernacchii is composed...

Ngày tải lên: 08/03/2014, 23:20

... (1983) Methylation analysis of complex carbohydrates in small amounts: capillary gas chromatography – mass fragmentography of meth- ylalditol acetates obtained from N-glycosidically linked glyco- protein ... 2002 Hemocyanin from the keyhole limpet Megathura crenulata (KLH) carries a novel type of N-glycans with Gal(b16)Man-motifs Tomofumi Kurokawa 1,2 ,...

Ngày tải lên: 31/03/2014, 08:20

... status, Review Aspects of early arthritis What determines the evolution of early undifferentiated arthritis and rheumatoid arthritis? An update from the Norfolk Arthritis Register Deborah PM Symmons and Alan J ... unnecessary risk to give them intensive DMARD therapy or even biologic therapy. On the other hand, some patients do very badly and fail t...

Ngày tải lên: 09/08/2014, 08:22

... system and the method to detect the early stage of degeneration of human articular cartilage. The signal intensity, considering tissue histology [4] and estimation of the mechanical property of ... charac- teristics of human cartilage in vivo is developed, we believe Letter Ultrasound has the potential to detect degeneration of articular cartila...

Ngày tải lên: 09/08/2014, 14:21

... sentinel of the syn- ovium, acting immediately in the event of joint trauma by liber- ating an array of proinflammatory mediators. However, MCs also appear to perpetuate the chronic process by their ... and to analysis and interpretation of the data. CDM, a medical writer at AB Science, contributed to data analysis and interpretation and was the main contributor in th...

Ngày tải lên: 09/08/2014, 14:22

... generalizability beyond the local context, and therefore should be eligible for research funding. The VA concept of QUERI Centers focused on a specific patient population or condition and mandated with addressing ... be challenging and confusing for the researcher and the study setting by blurring the line between research and tradi- tional quality improvement in...

Ngày tải lên: 11/08/2014, 05:21

... Central Page 1 of 3 (page number not for citation purposes) Journal of Medical Case Reports Open Access Case report Menstruating from the umbilicus as a rare case of primary umbilical endometriosis: ... of all cases of extragenital endometriosis. It usually occurs sec- ondary to surgical scars, but very rarely presents as pri- mary umbilical endometriosis...

Ngày tải lên: 11/08/2014, 14:21

... processes. Conclusion The global incidence of rare cases may be underestimated by contemporary international databases. Diseases which are currently considered to be rare in industrialized nations may occur at a ... Central State University Hospital, Ulaanbaatar, Mongolia, 3 Department of Surgery, Central State University Hospital, Ulaanbaatar, Mongolia and 4 Departmen...

Ngày tải lên: 11/08/2014, 19:21

... identity and 66-70% amino acid identity was found between the < /b> NS1 proteins. The < /b> NS allele A is more common and is the < /b> only subtype found in < /b> mammalian-adapted isolates. In < /b> a comparison between amino ... forward 5’ GGCCATGACCAACAAGTGTCTCCTCC 3’ and reverse 5’ ACAGGTTACCTCCGAAACTGAGCGC 3’ , resulting a product of 550 bp; and b- actin for...

Ngày tải lên: 11/08/2014, 21:21

... denominator popula- tion of patients with RA is not defined. The aim of the present study was to investigate trends in the incidence of primary THA and TKA in a well defined sample of patients with ... 14.29 THA, total hip arthroplasty. * Mean age for all observed patients in the cohort at the start of each calendar year Table 3 Incidence of...

Ngày tải lên: 12/08/2014, 15:23

... percentile of the estimated mortality predictions (inclusive of 90% of respond- ents) for each vignette as a measure of the variability in these predictions. The unit of analysis for all results was the ... predictions about mortality and mor- bidity vary widely. ã Older age, high BMI, and early-stage lung cancer are associated with poorer predictions...

Ngày tải lên: 13/08/2014, 16:21

Ngày tải lên: 13/08/2014, 18:21

... Ltd Highlights from the Critical Care Canada Forum 2009 – 25 to 28 October 2009, Toronto, Ontario, Canada Iain J McCullagh 1 and Damon C Scales 2 MEETING REPORT *Correspondence: Damon.scales@sunnybrook.ca 2 Department ...  e Critical Care Canada Forum was held in Toronto, Canada from 25 to 28 October 2009 [1].  e conference, which...

Ngày tải lên: 13/08/2014, 20:21