Báo cáo y học: "Early down-regulation of the pro-inflammatory potential of monocytes is correlated to organ dysfunction in patients after severe multiple injury: a cohort study" pptx

... intracellular cytokine synthesis by monocytes within the first 24 hours after traumaSevere multiple injury results in a rapid decline of intracellular cytokine synthesis by monocytes within the first ... and in risk adjustment as well as a monitoring device at the bedside. It seems reasonable to assume that the intensity of monocytic temporal paralysis, that is,...

Ngày tải lên: 13/08/2014, 16:21

... of the early synovitis patients are shown in Table 1. A total of 105 patients met the American College of Rheumatology criteria for RA. Of the patients meeting American College of Rheumatology ... duration less than 1 year. Patients were evaluated clinically and serologically, and radiographs were obtained at initial and 1-year visits. Sera were assayed for IgG- AG...

Ngày tải lên: 09/08/2014, 01:21

... m 2 )). Since the calculated uncertainty corresponds to an intralaboratory uncertainty it is an underestimate of the interlaboratory uncertainty that should be the basis for a recommendation. The ... uncertainty of S-Creatinine is about 14 µmol/L or one third. Therefore the use of MDRD-eGFR in diagnosis may be misleading and the large uncertainty is a dis...

Ngày tải lên: 08/08/2014, 16:23

... antigen of antineutrophil cytoplasmic antibodies with a cytoplasmic staining pattern (c-ANCA) in Wegener’s granulomatosis (WG). The WG disease appears as severe vasculitis in different organs (e.g. ... APAAP = alkaline phosphatase–antialkaline phosphatase; c-ANCA = antineutrophil cytoplasmic antibodies with a cytoplasmic staining pattern; PR-3 = proteinase-3; WG = Wegener’s gran...

Ngày tải lên: 09/08/2014, 03:24

... mRNA analysis), 10 days (for mRNA analysis and ALP assay), and 21 days (for cal- cium deposition assay). After 3 and 10 days of culture, total RNAs were extracted from the human MSCs. RT-PCR analy- sis ... basis of the expression of alkaline phosphatase (ALP) activity and incorporation of calcium in the extracellular matrix. The deposition of a mineralized matrix was f...

Ngày tải lên: 09/08/2014, 10:23

... Sicras-Mainar and colleagues reported data from medical practice in a multicenter primary care setting in Spain, covering a primarily urban population [1]. The study analyzed the incremental costs of ... adequate evidence supporting these feelings for FM overall is missing. There are few data on the costs of FM and the data differ. The approaches range from analyzing l...

Ngày tải lên: 09/08/2014, 14:21

... placed on the plantar surface of the interphalangeal joint of the hallux and the most posterior plantar aspect of the calcaneus to record the timing of heel contact, toe contact, heel off and toe ... truncated, CIA calcaneal inclination angle, C1MA calcaneal first metatarsal angle, TNCA talo-navicular coverage angle, T2MA talus-second metatarsal angle. FC denotes th...

Ngày tải lên: 10/08/2014, 21:24

... 5'GAAACTCCAAACACCACAGAGGAC CCR1 antisense 5'TTCGTGAGGAAAGTGAAGGCTG CCR2 sense 5'CCACATCTCGTTCTCGGTTTATCAG CCR2 antisense 5'CGTGGAAAATAAGGGCCACAG CCR3 sense 5'CACTAGATACAGTTGAGACCTTTGG CCR3 ... 5'CACTAGATACAGTTGAGACCTTTGG CCR3 antisense 5'GGTAAAGAGCACTGCAAAGAGTC CCR4 sense 5'ACCCCACGGATATAGCAGATACC CCR4 antisense 5'CGTCGTGGAGTTGAGAGAGTACTTG CCR5 sen...

Ngày tải lên: 11/08/2014, 08:21

... differential diagnosis. Introduction Tularemia, caused by the facultative intracellular Gram- negative bacterium Francisella tularensis, is endemic in cer- tain areas of the northern hemisphere. In France, ... the analysis of bacterial tests and in writing a first draft, PYL participated in collecting the data and in following the patient's case, and contribut...

Ngày tải lên: 11/08/2014, 21:22

... chemistry A pilot study by Abid and colleagues has demonstrated that an increasing urinary microalbumin over the first 48hours of ICU admission appears to accurately predict the evolution of acute ... months have seen a variety of important and thought provoking studies published. Respiratory medicine February saw the publication of the large scale Australian ALI/ARDS ep...

Ngày tải lên: 12/08/2014, 18:21