Báo cáo y học: "Dexmedetomidine vs haloperidol in delirious, agitated, intubated patients: a randomised open-label trial" pps

... extubation. In the primary analysis, patients who underwent tracheostomy were analysed as having been extu- bated at that point (see discussion for rationale), but in a sup- plementary analysis ... into which a card indi- cating patient allocation had been placed according to a computer-generated random-number sequence. Dexmedeto- midine was administered intravenously as a mainten...

Ngày tải lên: 13/08/2014, 16:20

... Paulo Fernandes 1 , Sofia Jorge 1 , Sara Gonçalves 1 , António Alvarez 2 , Zélia Costa e Silva 2 , Carlos Fran a 2 and Mateus Martins Prata 1 1 Department of Nephrology and Renal Transplantation, ... 2006. Variables such as age, gender, race, body weight, history of cardiovas- cular disease (angina pectoris, myocardial infarction, cere- brovascular disease, and diabetes mellitus), primary...

Ngày tải lên: 13/08/2014, 11:22

... without increasing free fatty acid concentration. During starvation homeostatic mechanisms attempt to maintain a minimal acceptable blood glucose concentration, in part to maintain neurons that cannot ... 7:15 http://www.tbiomed.com/content/7/1/15 Page 41 of 44 19. Eto K, Tsubamoto Y, Terauchi Y, Sugiyama T, Kishimoto T, Takahashi N, Yamauchi N, Kubota N, Murayama S, Aizawa T, et al.:...

Ngày tải lên: 13/08/2014, 16:20

... investigator at a centralized location blinded to all company names. Each participating employer is matched to another participating employer inthesamecoalitionbyworkforcesizebeforethe employer ... purchase defined as a dichotomous variable. Descriptive, moderating, and mediating vari- ables will be defined in subsequent manuscripts testing the study’s hypotheses. Data Analysis The rese...

Ngày tải lên: 11/08/2014, 05:21

... average of 7,44 ± 6,82 years of pain in the alexithymic and 3,31 ± 2,79 years in the nonalexithymic groups. Persistency of any physical symptom may bring along alexithymia as a coping strategy. In ... [23]. Regarding the pain assessment, information was first obtained on several aspects of the patients' pain, such as intensity, and duration. Pain intensity was measured by Visual...

Ngày tải lên: 08/08/2014, 21:20

... was assessed through a chart review, medical doctor referee and psychiatrist interview. Data analyses Statistical analysis was performed by SPSS 12.0 program. An initial exploratory analysis involved ... eating symptomatology may play an important role in the initi- ation and maintenance of the WG phenomenon observed in at least part of patients with schizophrenia. Finally, management o...

Ngày tải lên: 08/08/2014, 21:20

... Expression of vascular cell adhesion molecule-1 in normal and inflamed synovium. Lab Invest 1993, 68:82-88. 30. Higashiyama H, Saito I, Hayashi Y, Miyasaka N: In situ hybridiza- tion study of vascular cell ... 35:1541. 74. Nakashima M, Eguchi K, Aoyagi T, Yamashita I, Ida H, Sakai M, Shimada H, Kawabe Y, Nagataki S, Koji T, et al.: Expression of basic fibroblast growth factor in synov...

Ngày tải lên: 09/08/2014, 01:23

... Standard of keratan sulfate purified from human costal cartilage [20]. The intra-assay variation was <3%, and the inter-assay variation was <4%. Measurement of HA by ELISA Hyaluronan in ... nonkeratan-sulfate-contain- ing rat chondrosarcoma proteoglycans that capture HA and the keratan-sulfate-bearing aggregating proteoglycans that are subsequently added. The assay produces very simil...

Ngày tải lên: 09/08/2014, 08:22

... analysis. Analysis was performed by analysis of variance (ANOVA), multivariate ANOVA and repeated measures ANOVA, as indicated. Factor analysis was utilized to detect relationships between positive autonomic ... data in response to five standard cardiovascular reflex tests were digitally recorded using a noninvasive finger pressure cuff and heart rate variability was analyzed by Fourier s...

Ngày tải lên: 09/08/2014, 10:23

... 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3' siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA-3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3' siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' ... 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3' siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTAT...

Ngày tải lên: 09/08/2014, 10:23