Báo cáo y học: " Defining the buffering process by a triprotic acid without relying on stewart-electroneutrality considerations" pps
Báo cáo y học: " Defining the buffering process by a triprotic acid without relying on stewart-electroneutrality considerations" pps
... mathematical
convenience of electroneutrality/charge balance considerations as had previous authors.
Our reasoning was based on the consideration that if a deriva tion based only on parti-
tioning of H
+
buffering ... that one can mathematically model the
chemistry of acid- base phenomenology without relying on electroneutrality (Stewart
formulation) considerations.
Keyword...
Báo cáo y học: "Defining the chromatin signature of inducible genes in T cells" pps
... human data set contains information about a number of
other acetylation marks and we found that the majority of the
acetylation marks showed a similar pattern to H3K9ac, with
H2AK9ac, H2BK20ac, ... 1a; Additional data file 7). Because the underlying histone
density can vary across the genome, especially at promoter
regions, the H3K9 acetylation values were also calculated rel-
a...
Báo cáo y học: "Acute heart failure caused by a giant hepatocellular metastatic tumor of the right atrium" pps
... cardiopulmonary bypass (CPB). Thus the
pericardial cavity co uld be approached with safety. After
median sternotomy, the superior vena cava was also
cannulated and transfixed and then antegrade ... made
substantial contributions to acquisition of data. SZ: Has made substantial
contributions to acquisition of data. EA: Has made substantial contributions
to conception and design.
All author...
Báo cáo y học: " Is the PANSS used correctly? a systematic review" doc
... Germany.
Authors’ contributions
MO performed the analyses of the found articles and elaborated the
conception of the manuscript, including a first draft. RS-W participated in
the conception of the ... scales straightforward calculation of relative changes is not appropriate. To calculate
outcome criteria based on a percent change as, e.g., the widely accepted response crit...
Báo cáo y học: " Analysing the eosinophil cationic protein - a clue to the function of the eosinophil granulocyte" ppt
...
ctgaacccccctcgatgcaccattgcaatgcgggcaattaacaattatcga
18 L N P P R C T I A M R A I N N Y R
tggcgttgcaaaaaccaaaatacttttcttcgtacaacttttgctaatgta
35 W R C K N Q N T F L R T T F A N V
gttaatgtttgtggtaaccaaagtatacgctgccctcataacagaactctc
52 ...
aacaattgtcatcggagtagattccgggtgcctttactccactgtgacctc
69 N N C H R S R F R V P L L H C D L
c
ataaatccaggtgcacagaatatttcaaactgcaggtatgcagacagacca
86...
Báo cáo y học: "Scanning the horizon: emerging hospital-wide technologies and their impact on critical care" pot
... selection and data collection handed to the
regional private sector consortia and to national audit bodies.
Clinician engagement and choice may not feature highly on
the agenda, and there are clear ... clinical practice and patient safety, and
intensivists are strongly recommended to consult early and
engage with those driving their local and national health
economy.
Conclusion
A vari...
Báo cáo y học: "Through the rear view mirror: a content evaluation of the journal of Chiropractic & Osteopathy for the years 2005–2008" pps
... is therefore an appropriate time to look back over the
last three years and assess the extent to which the journal
has achieved these goals. Ultimately you are what you do
not what you say, however, ... likely impact of the journal and
perhaps the future. While the latter are speculative, they
are based on the data of the journal itself. So we might
claim it is grounded spec...
Báo cáo Y học: Characterization of heparin binding by a peptide from amyloid P component using capillary electrophoresis, surface plasmon resonance and isothermal titration calorimetry ppt
... A measurement of the distance between the Lys and Arg
in AP-1 shows that they are 27 A
˚
apart while the same
residues are separated by 11 A
˚
in the random conforma-
tion of the scrambled ... hexasaccharide, octasaccharide, decasaccharide,
dodecasaccharide and tetradecasaccharide, and DUA is
4-deoxy -a-
L
-threo-hexenopyranosyluronic acid) , were pre-
pared from bovine...
Báo cáo y học: " Haemoptysis in pregnancy caused by a well-differentiated fetal adenocarcinoma: a case report" docx
... frequently assumed to be caused by a pul-
monary embolism, which is a relatively common
pathology in pregnancy. However, as in the non-preg-
nant population, it can be caused by a number of other
conditions ... exertion.
Discussion
Well-differentiated fetal adenocarcinoma (WDFA) is
classified by the World Health Organisation as a variant
of adenocarcinoma. When fetal adenoca...
Báo cáo y học: " Effects of intratracheal administration of nuclear factor-kappaB decoy oligodeoxynucleotides on long-term " ppsx
... macrophage aggregation in smoke-induced chronic inflammation on day 92Figure 3
NF-κB decoy ODNs attenuated macrophage aggregation in smoke-induced chronic inflammation on day 92.
(A) Alveolar macrophages ... microscopy with haematoxylin-eosin staining. The lesion was character-
ized by disseminated foci of airspace destruction interspersed by apparently normal parenchyma. Original...
Từ khóa: