Báo cáo y học: " Defining the buffering process by a triprotic acid without relying on stewart-electroneutrality considerations" pps

Báo cáo y học: " Defining the buffering process by a triprotic acid without relying on stewart-electroneutrality considerations" pps

Báo cáo y học: " Defining the buffering process by a triprotic acid without relying on stewart-electroneutrality considerations" pps

... mathematical convenience of electroneutrality/charge balance considerations as had previous authors. Our reasoning was based on the consideration that if a deriva tion based only on parti- tioning of H + buffering ... that one can mathematically model the chemistry of acid- base phenomenology without relying on electroneutrality (Stewart formulation) considerations. Keyword...

Ngày tải lên: 13/08/2014, 16:20

11 350 0
Báo cáo y học: "Defining the chromatin signature of inducible genes in T cells" pps

Báo cáo y học: "Defining the chromatin signature of inducible genes in T cells" pps

... human data set contains information about a number of other acetylation marks and we found that the majority of the acetylation marks showed a similar pattern to H3K9ac, with H2AK9ac, H2BK20ac, ... 1a; Additional data file 7). Because the underlying histone density can vary across the genome, especially at promoter regions, the H3K9 acetylation values were also calculated rel- a...

Ngày tải lên: 09/08/2014, 20:20

18 641 0
Báo cáo y học: "Acute heart failure caused by a giant hepatocellular metastatic tumor of the right atrium" pps

Báo cáo y học: "Acute heart failure caused by a giant hepatocellular metastatic tumor of the right atrium" pps

... cardiopulmonary bypass (CPB). Thus the pericardial cavity co uld be approached with safety. After median sternotomy, the superior vena cava was also cannulated and transfixed and then antegrade ... made substantial contributions to acquisition of data. SZ: Has made substantial contributions to acquisition of data. EA: Has made substantial contributions to conception and design. All author...

Ngày tải lên: 10/08/2014, 09:22

4 396 0
Báo cáo y học: " Is the PANSS used correctly? a systematic review" doc

Báo cáo y học: " Is the PANSS used correctly? a systematic review" doc

... Germany. Authors’ contributions MO performed the analyses of the found articles and elaborated the conception of the manuscript, including a first draft. RS-W participated in the conception of the ... scales straightforward calculation of relative changes is not appropriate. To calculate outcome criteria based on a percent change as, e.g., the widely accepted response crit...

Ngày tải lên: 11/08/2014, 15:22

5 298 0
Báo cáo y học: " Analysing the eosinophil cationic protein - a clue to the function of the eosinophil granulocyte" ppt

Báo cáo y học: " Analysing the eosinophil cationic protein - a clue to the function of the eosinophil granulocyte" ppt

... ctgaacccccctcgatgcaccattgcaatgcgggcaattaacaattatcga 18 L N P P R C T I A M R A I N N Y R tggcgttgcaaaaaccaaaatacttttcttcgtacaacttttgctaatgta 35 W R C K N Q N T F L R T T F A N V gttaatgtttgtggtaaccaaagtatacgctgccctcataacagaactctc 52 ... aacaattgtcatcggagtagattccgggtgcctttactccactgtgacctc 69 N N C H R S R F R V P L L H C D L c ataaatccaggtgcacagaatatttcaaactgcaggtatgcagacagacca 86...

Ngày tải lên: 12/08/2014, 13:22

20 315 0
Báo cáo y học: "Scanning the horizon: emerging hospital-wide technologies and their impact on critical care" pot

Báo cáo y học: "Scanning the horizon: emerging hospital-wide technologies and their impact on critical care" pot

... selection and data collection handed to the regional private sector consortia and to national audit bodies. Clinician engagement and choice may not feature highly on the agenda, and there are clear ... clinical practice and patient safety, and intensivists are strongly recommended to consult early and engage with those driving their local and national health economy. Conclusion A vari...

Ngày tải lên: 12/08/2014, 20:21

4 200 0
Báo cáo y học: "Through the rear view mirror: a content evaluation of the journal of Chiropractic & Osteopathy for the years 2005–2008" pps

Báo cáo y học: "Through the rear view mirror: a content evaluation of the journal of Chiropractic & Osteopathy for the years 2005–2008" pps

... is therefore an appropriate time to look back over the last three years and assess the extent to which the journal has achieved these goals. Ultimately you are what you do not what you say, however, ... likely impact of the journal and perhaps the future. While the latter are speculative, they are based on the data of the journal itself. So we might claim it is grounded spec...

Ngày tải lên: 13/08/2014, 14:20

4 147 0
Báo cáo Y học: Characterization of heparin binding by a peptide from amyloid P component using capillary electrophoresis, surface plasmon resonance and isothermal titration calorimetry ppt

Báo cáo Y học: Characterization of heparin binding by a peptide from amyloid P component using capillary electrophoresis, surface plasmon resonance and isothermal titration calorimetry ppt

... A measurement of the distance between the Lys and Arg in AP-1 shows that they are  27 A ˚ apart while the same residues are separated by 11 A ˚ in the random conforma- tion of the scrambled ... hexasaccharide, octasaccharide, decasaccharide, dodecasaccharide and tetradecasaccharide, and DUA is 4-deoxy -a- L -threo-hexenopyranosyluronic acid) , were pre- pared from bovine...

Ngày tải lên: 31/03/2014, 23:20

8 348 0
Báo cáo y học: " Haemoptysis in pregnancy caused by a well-differentiated fetal adenocarcinoma: a case report" docx

Báo cáo y học: " Haemoptysis in pregnancy caused by a well-differentiated fetal adenocarcinoma: a case report" docx

... frequently assumed to be caused by a pul- monary embolism, which is a relatively common pathology in pregnancy. However, as in the non-preg- nant population, it can be caused by a number of other conditions ... exertion. Discussion Well-differentiated fetal adenocarcinoma (WDFA) is classified by the World Health Organisation as a variant of adenocarcinoma. When fetal adenoca...

Ngày tải lên: 11/08/2014, 14:21

4 258 0
Báo cáo y học: " Effects of intratracheal administration of nuclear factor-kappaB decoy oligodeoxynucleotides on long-term " ppsx

Báo cáo y học: " Effects of intratracheal administration of nuclear factor-kappaB decoy oligodeoxynucleotides on long-term " ppsx

... macrophage aggregation in smoke-induced chronic inflammation on day 92Figure 3 NF-κB decoy ODNs attenuated macrophage aggregation in smoke-induced chronic inflammation on day 92. (A) Alveolar macrophages ... microscopy with haematoxylin-eosin staining. The lesion was character- ized by disseminated foci of airspace destruction interspersed by apparently normal parenchyma. Original...

Ngày tải lên: 12/08/2014, 14:20

14 154 0
Từ khóa:
w