Báo cáo y học: " A nucleotide binding rectification Brownian ratchet model for translocation of Y-family DNA polymerases Ping Xie" pot
Báo cáo y học: " A nucleotide binding rectification Brownian ratchet model for translocation of Y-family DNA polymerases Ping Xie" pot
... model for translocation of Y- family DNA polymerases Ping Xie Correspondence: pxie@aphy.iphy. ac.cn Key Laboratory of Soft Matter Physics and Beijing National Laboratory for Condensed Matter Physics, ... Institute of Physics, Chinese Academy of Sciences, Beijing 100190, China Abstract Y- family DNA polymerases are characterized by low-fidelity synthesis on undamage...
Ngày tải lên: 13/08/2014, 16:20
Báo cáo y học: "A TATA binding protein regulatory network that governs transcription complex assembly" pdf
... support. Biological systems are a balance of assembly and disassembly processes that typically move along different pathways. Thus, PIC disassembly and RNA degradation do not proceed by an exact reversal of ... SAGA pathway is tailored towards TATA-containing promoters, whereas the TFIID pathway plays a greater role at TATA-less promoters [23]. Inhibiting the SAGA pathway (but not the...
Ngày tải lên: 14/08/2014, 20:22
Tài liệu Báo cáo Y học: A novel, inducible, citral lyase purified from spores of Penicillium digitatum docx
... equivalent of this reaction the actions of a hydratase and an aldolase are needed. Citral lyase of P. digitatum combines hydratase and aldolase activity in a single enzyme. No other enzyme has been ... and average spore size did not change during induction. Stability of citral lyase activity The activity and stability of citral lyase was dramatically affected by the addition of...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo Y học: Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae ppt
... GTCGGATCCTCTAGACAGCTCCATGTTCACTG GCACTGGTAGAATTCGGC), 3 (TGCCGAATTCTA CCAGTGCCAGTGAAGGACATCTTTGCCCACGTTG ACCC), 4 ( CAACGTCATAGACGATTACATTG CTAC ATGGAGCTGTCTAGAGGATCCGA). A three-strand junction was made by o mitting strand ... mitting strand 4 and a 37-bp duplex DNA by annealing oligonucleotides 5 (bio-AATGCTA CAGTATCGTCCGGTCACGTACAACATCCAG) and 6 (CTGGATGTTGTACGTGACCGGACGATACTGT AGCAT...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo Y học: A single charged surface residue modifies the activity of ikitoxin, a beta-type Na+ channel toxin from Parabuthus transvaalicus doc
... Activity against insects was tested by injecting blow y and cabbage looper larvae. All animal care and experimental protocols conformed to the guidelines of the Animal Use and Care Administrative Advisory ... Inceoglu is partially funded by Ankara University. Y. Hayashida and A. T. Ishida thank Dr B. Mulloney for use of the voltage-clamp amplifier described herein. Fig. 7. Modeling o...
Ngày tải lên: 31/03/2014, 08:20
Báo cáo y học: "Small GTP-binding protein Rho-mediated signaling promotes proliferation of rheumatoid synovial fibroblast" pot
... cells. Introduction Rheumatoid arthritis (RA) is characterized by synovial pro- liferation, neovascularization, and accumulation of inflam- matory cells in inflamed joints. Synovial cells are markedly activated by cytokines, ... nonfat milk, and analyzed by western blotting using a polyclonal anti-Rho antibody. Statistical analysis Data are expressed as mean ± standard deviation (SD) of...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "A functional difficulty and functional pain instrument for hip and knee osteoarthritis" ppsx
... Simulations are approximations of actual CAT administrations, and although they are likely to be good estimates, they may overestimate agreement between CAT and full item bank scores. Another area ... bank for the entire sample and by site of OA. We considered the following characteristics in our analysis: accuracy, breadth of coverage, reliability, and precision. We assessed the accu...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: " Mitral valve replacement via right thoracotomy approach for prevention of mediastinitis in a female patient with long-term uncontrolled diabetes mellitus: a case report" potx
... 30-day mortality rate, major complications such as renal failure and neurological deficits, and 5-year overall survival for these approaches for mitral valve are satisfactory. The advantages of these ... (NYHA) functional classification of 3/4. Laboratory examination revealed plasma creatinine of 1.06 mg/dl and a hemoglo- bin A1 c of 9.4%. Transthoracic echocardiography reveale...
Ngày tải lên: 10/08/2014, 09:22
Báo cáo y học: "A novel method to identify and characterise peptide mimotopes of heat shock protein 70-associated antigens" pptx
... Andreola G, Sertoli MR, Gallino G, Piris A, Cattelan A, Lazzari I, Carrabba M, Scita G, Santantonio C, Pilla L, Tragni G, Lombardo C, Arienti F, Marchiano A, Queirolo P, Bertolini F, Cova A, Lamaj ... 64:4995-5003. 27. Foon KA, Bhattacharya-Chatterjee M: Are Solid Tumor Anti-Idi- otype Vaccines Ready for Prime Time? Commentary re: U. Wagner et al., Immunological Consolidation of Ovari...
Ngày tải lên: 11/08/2014, 10:23
Báo cáo y học: "A steady state analysis indicates that negative feedback regulation of PTP1B by Akt elicits bistability in insulin-stimulated GLUT4 translocation" potx
... plasma Schematic representation of metabolic Insulin signaling pathway used for the steady state analysisFigure 2 Schematic representation of metabolic Insulin signaling pathway used for the steady ... experimental data, computational and mathe- matical analysis can answer some of these questions and possibly propose new experiments and hypotheses. Ear- lier mathematical modeling st...
Ngày tải lên: 13/08/2014, 22:22