Báo cáo y học: "Disruption of cell wall fatty acid biosynthe

Báo cáo y học: "Presence of antibodies against cyclic citrullinated peptides in patients with ''''rhupus'''': a cross-sectional study" pdf

... the immunoassays. RM-V participated in the analysis and interpretation of data and performed the statistical analysis. LG-G participated in the analysis and interpretation of data. AV participated ... anti-CCP antibodies = antibodies against cyclic citrullinated peptides; anti-dsDNA antibodies = antibodies against double-stranded DNA; ELISA = enzyme-linked immuno...

Ngày tải lên : 09/08/2014, 08:22

5
541
0

Báo cáo y học: "Cardiovascular risk factors and acute-phase response in idiopathic ascending aortitis: a case control study" pptx

... history of any aortic aneurysms, and elevated inflammatory markers differed between cases and controls. Results The mean age of cases was 71.6 ± 8.9 years and that of controls was 71.1 ± 8.9 years. ... systemic inflammatory diseases, thoracic aneurysms and aortitis occur in giant cell arteritis (GCA), Takayasu arteritis, anti-neutrophil cyto- plasmic antibody (ANCA)-associated gra...

Ngày tải lên : 09/08/2014, 13:22

6
366
0

Báo cáo y học: "Identification of novel genetic susceptibility loci for Behçet''''s disease using a genome-wide association study" pps

... the acquisition of data. RW performed the acquisition and analysis of data. BLC performed the analysis of pooling data. HD and GS-D provided DNA samples, made a substantial contribution to the acquisition ... technology and the Affymetrix 500K arrays, we identified possible candidate gene associations with Behỗet's disease in a cohort of 152 Behỗet's disease patients...

Ngày tải lên : 09/08/2014, 14:20

7
381
0

Báo cáo y học: " Outcome of left heart mechanical valve replacement in West African children - A 15-year retrospective study." pdf

... valve replacement in West African children - A 15-year retrospective study Frank Edwin * , Ernest Aniteye, Mark Mawutor Tettey, Martin Tamatey and Kwabena Frimpong-Boateng Abstract Background: The West African ... Barnard BJ, le Roux PJ, van Wyk HWJ: Mitral valve replacement at Tygerberg Hospital: a 5 year follow-up. SAHeart 2010, 7:3 0-3 7. 9. WHO Global Hea...

Ngày tải lên : 10/08/2014, 09:21

8
538
0

Báo cáo y học: "Development of recurrent facial palsy during plasmapheresis in Guillain-Barré syndrome: a case report" pdf

... developed ascending motor weakness and laboratory findings consistent with a diagnosis of Guillain-Barré syndrome. Plasmapheresis was initiated. Acute facial palsy developed during the plasma exchange ... right- sided facial weakness with dysgeusia, and an obvious facial droop appeared. The remainder of his neurological examination, including contralateral facial strengt...

Ngày tải lên : 11/08/2014, 03:21

4
348
0

Báo cáo y học: "Role of positron emission tomography-computed tomography in bronchial mucoepidermoid carcinomas: a case series and review of the literature" pdf

... this article as: Jindal et al.: Role of positron emission tomography- computed tomography in bronchial mucoepidermoid carcinomas: a case series and review of the literature. Journal of Medical Case ... manuscript, AK had a major contribution in the analysis and editing, RK helped in the study design and data acquisition, RD contributed in da...

Ngày tải lên : 11/08/2014, 03:21

4
210
0

Báo cáo y học: "Effectiveness of electronic guideline-based implementation systems in ambulatory care settings - a systematic review" pot

... setting and characteristics may be different from everyday practice. The characteristics of the healthcare system in each coun- try (e.g., financing systems) may also be important when generalising ... [13] Cluster-RCT moderate 200 patients, 17 primary care physicians Guideline-based treatment advice for depression Active care Passive care N N N N van Wyk [32] Cluster-RCT modera...

Ngày tải lên : 11/08/2014, 05:21

12
361
0

Báo cáo y học: " Development of recurrent facial palsy during plasmapheresis in Guillain-Barré syndrome: a case report" pot

... dysgeusia, and an obvious facial droop appeared. The remainder of his neurological examination, including contralateral facial strength, remained unchanged. A brain magnetic resonance ima- ging ... the remainder of his facial paralysis persisted. Because of the association of recurrent acute facial weakness during plasmapheresis, the therapy was dis- continued and a d...

Ngày tải lên : 11/08/2014, 07:20

4
329
0

Báo cáo y học: " Characterization of influenza virus sialic acid receptors in minor poultry species" potx

... attenuated vaccines against viruses with a a2,6 binding preference in young turkeys and in ovo inoculations. Lectin binding patterns are not indicative of virus binding patterns Glycan micro arrays have ... hemagglutinin bind to alpha2,8-linked sialic acid. Virology 2004, 325:11. 17. Gambaryan A, Tuzikov A, Pazynina G, Bovin N, Balish A, Kilmov A: Evolution of the receptor bindi...

Ngày tải lên : 11/08/2014, 21:21

10
824
0

Báo cáo y học: " Candida soluble cell wall β-glucan facilitates ovalbumin-induced allergic airway inflammation in mice: Possible role of antigen-presenting cells" ppt

... β-glucan facilitates ovalbumin-induced allergic airway inflammation in mice: Possible role of antigen-presenting cells Ken-ichiro Inoue* 1 , Hirohisa Takano 1 , Eiko Koike 1 , Rie Yanagisawa 1 , ... quantify the infiltration of inflammatory leukocytes around the airways, we expressed the number of these cells per length of basement membrane of the airways. The...

Ngày tải lên : 12/08/2014, 14:20

12
246
0

Báo cáo y học: " Activation of tumor necrosis factor receptor 1 in airway smooth muscle: a potential pathway that modulates bronchial hyper-responsiveness in asthma?" ppsx

... primary research commentary review reports primary research Review Activation of tumor necrosis factor receptor 1 in airway smooth muscle: a potential pathway that modulates bronchial hyper-responsiveness ... characterized by airway inflammation, exaggerated airway reactivity to contractile agonists, and a decrease in β-adrenoceptor-mediated airwa...

Ngày tải lên : 12/08/2014, 18:20

5
223
0

Báo cáo y học: "Disruption of cell wall fatty acid biosynthesis in Mycobacterium tuberculosis using a graph theoretic approach" pptx

... input. Results Data for assessing the pathway are available in the KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway database and were used to obtain a flowchart of the fatty acid biosynthesis pathway of ... is available at the end of the article Abstract Fatty acid biosynthesis of Mycobacterium tuberculosis was analyzed using graph theory and influentia...

Ngày tải lên : 13/08/2014, 16:20

13
345
0

Báo cáo y học: " Implementation of an evidence-based sepsis program in the intensive care unit: evident or not" pptx

... quarter by 2009 by means of a six-point action plan, namely, building awareness among health care professionals, improving early and accurate disease recognition and diagnosis, increasing the use of appropriate ... evidence-based sepsis program in the intensive care unit: evident or not? Dominique M Vandijck 1,2 , Stijn I Blot 1,3,4 and Dirk P Vogelaers 1,3,4 1 Dep...

Ngày tải lên : 13/08/2014, 19:20

3
251
0

Báo cáo y học: "MONKEY: identifying conserved transcription-factor binding sites in multiple alignments using a binding site-specific evolutionary model" ppsx

... CATTTGCCACTCACGAACAAGAATAAAAGAATTTAGGTATTCTAGAATGCCCAAAAGGTAACGGCAATACA YLR387C_Skud AAATTGCCACTTACGAAGGAGAATAAAACAGCTCAGATATTCTTAGACACTCCAAGGGCAGTGACAATACA YLR387C_Sbay AAATTGCCACTCAGGAAAGAGAAGTGATATAATTAGATGTTCT ... region. YLR387C_Scer AAATTGCCACTCACGAAAGAGAATAAAACGACTTAGTCAT-ATGCAATAGTCACAAGACGGTGGCAACACA YLR387C_Spar AAATTGCCACTCACGAAGGAGAATAAAACAACTCAGTCGTCATGCAATACCCAAAAGACGGTGGCAATAAA...

Ngày tải lên : 14/08/2014, 14:21

15
288
0

Báo cáo y học: "Identification of ciliated sensory neuron-expressed genes in Caenorhabditis elegans using targeted pull-down of poly(A) tails" ppsx

... sensory neurons of Caenorhabditis elegans using the mRNA-tagging method, in which poly(A) RNA was co-immunoprecipitated with an epitope-tagged poly(A)- binding protein specifically expressed in sensory ... epitope-tagged PABP using cell-specific promoters. Since PABP binds the poly(A) tails of mRNA [20], in situ crosslinking of RNA and proteins, followed by affini...

Ngày tải lên : 14/08/2014, 14:21

13
301
0