Báo cáo y học: " Research Transperineal prostate biopsy: analysis of a uniform core sampling pattern that yields data on tumor volume limits in negative biopsies" pdf

... Access RESEARCH Research Transperineal prostate biopsy: analysis of a uniform core sampling pattern that yields data on tumor volume limits in negative biopsies Gordon R Kepner* 1 and Jeremy V Kepner 2 Abstract Background: ... Kepner 2 Abstract Background: Analyze an approach to distributing transperineal prostate biopsy cores that yields data...

Ngày tải lên: 13/08/2014, 16:20

... National de la Recherche Scientifique, Gif-sur-Yvette, France Mammalian tubulins and actins attain their native con- formation following interactions with CCT (the cytosolic chaperonin containing ... which are components of the eukaryotic cytoskeleton. Misfolded actin and tubulin appear to bind to the apical domain of the CCT ring [9,10] in a nearly native conformation [10,11]. Substra...

Ngày tải lên: 23/03/2014, 21:20

... RESEARCH Open Access Chemical fingerprinting and quantitative analysis of a Panax notoginseng preparation using HPLC-UV and HPLC-MS Hong Yao, Peiying Shi, Qing Shao, Xiaohui Fan * Abstract Background: ... through a 0.45 μmnylon membrane (Whatman, Britain). Spiked injection was produced by mixing sample solutions with the reference solutions at the ratio of 1:1. Data analysis...

Ngày tải lên: 13/08/2014, 14:20

... increased sweating. Most commonly it is associated with an intrathoracic malignancy, which can be carcinoma of the lung as well as pulmonary metastasis of other tumors and Hodgkin's dis- ease ... ratio on skeletal scintigraphy, with a uniform symmetrical increase in bone uptake and diminished to absent renal visualization ('absent kidney sign'). It can be seen in...

Ngày tải lên: 11/08/2014, 23:21

... ChIP-Seq data that is based on ChIP-Seq sample only and that retains and even improves the accuracy and statistical power of binding site discovery. Wu et al. Theoretical Biology and Medical Modelling ... transcription factor (TF) binding on the basis of ChIP-Seq data only. An analysis of real genomic data is presented to demonstrate our method. Conclusions: In a co...

Ngày tải lên: 13/08/2014, 16:20

... GTCGGATCCTCTAGACAGCTCCATGTTCACTGGCACTGGTAGAATTCGGC HJ7 TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCC HJ8 CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGA HJ1 AGAAGCTCCATGTAGCAAGGCTAG HJ2 ... Bio-AATGCTACAGTATCGTCCGGTCACGTACAACATCCAG ASP2 CTGGATGTTGTACGTGACCGGACGATACTGTAGCATT DU1 Bio-GTACGAGCAGCTCCCGGGTCAGTCTGCCTA DU2 TAGGCAGACTGACCCGGGAGCTGCTCGTAC HJ5 Bio-AAAAATGGGTCAACGTGGGCAAAGATGTCC...

Ngày tải lên: 21/02/2014, 01:21

... Terao, Y. , Yano, T., Yamamoto, T., Kawamata, Y. , Habata, Y. , Asada, M., Kitada, C., Kurokawa, T., Onda, H., Nishimura, O., Tanaka, M., Ibata, Y. & Fujino, M. (2000) New neuropeptides containing carboxy-terminal ... Brandt, A. & Pertovaara, A. (1999) Neuropeptide FF and modulation of pain. Brain Res. 848, 191–196. 8. Ibata, Y. , Iijima, N., Kataoka, Y. , Kakihara, K., Tan...

Ngày tải lên: 08/03/2014, 16:20

... insertion library with a thin layer chromatographic assay [14]. A single mutant clone was detected that produced neutral OPGs. Actually, this partic- ular phenotype allowed the demonstration of acetyl ... chromatography, which allows for the separation of subfractions of glucan by their anionic character. OPGs extracted from WS8 were separated into five main subfractions eluted at...

Ngày tải lên: 17/03/2014, 17:20

... doi:10.1046/j.1432-1033.2002.03282.x corresponding to an apparent molecular mass of 120 kDa. Protein was concentrated by ultrafiltration and analyzed by SDS/PAGE. Determination of enzyme activities The assays were routinely carried ... below). A linear increase of activity with increasing protein concentrations was obtained, even at protein concentrations as low as 45 lg per mL assay m...

Ngày tải lên: 23/03/2014, 21:20

... attacker can intentionally delay t he beacon frames by sending low rate forgery beacon frames. In contrast, the synchronization attack does not have an y impact over the normal performance of the ACFNC model. ... DoS Attacks Mina Malekzadeh, Abdul Azim Abdul Ghani, and Shamala Subramaniam Faculty of Computer Science and Information Technology, Universiti of Putra Malaysia, 43400 UPM...

Ngày tải lên: 21/06/2014, 05:20