Báo cáo y học: "Research Saturation Behavior: a general relationship described by a simple second-order differential equation" ppt

... Access RESEARCH Research Saturation Behavior: a general relationship described by a simple second-order differential equation Gordon R Kepner Abstract Background: The numerous natural phenomena that ... integrated and applied to illustrative examples. Results Basic saturation behavior case The general nature of the initial extensive mathematical analysis suggests us...

Ngày tải lên: 13/08/2014, 16:20

... Tsubamoto Y, Terauchi Y, Sugiyama T, Kishimoto T, Takahashi N, Yamauchi N, Kubota N, Murayama S, Aizawa T, et al.: Role of NADH shuttle system in glucose- induced activation of mitochondrial ... synthesis at high workloads can also be limited by glycolysis due to a decreased cytoplasmic NAD + availability for glyceraldehyde 3-phosphate dehydrogenase [18,118]. We simulated the phosphory...

Ngày tải lên: 13/08/2014, 16:20

... Space Lihua Li, 1 Suhong Li, 1 and Yongfu Su 2 1 Department of Mathematic and Physics, Hebei Normal University of Science and Technology Qinhuangdao, Hebei 066004, China 2 Department of Mathematics, ... the above proof that Theorem 2.2 is valid for nonexpansive mappings. Thus, we have that Corollaries 2.3 and 2.4 are two special cases of Theorem 2.2. Corollary 2.3. Let T be a nonexpansive m...

Ngày tải lên: 21/06/2014, 23:20

... mediators. Ann N Y Acad Sci 1989, 557:310-5; discussion 315-6. 2. Shimada H, Hasegawa N, Koh H, Tasaka S, Shimizu M, Yamada W, Nishimura T, Amakawa K, Kohno M, Sawafuji M, Nakamura K, Fujishima ... 5'-ATT ACC TCT TAG AGT CAG TTC ATG G-3'; β-actin [GenBank: X03672 ], sense: 5'-ATG GAT GAC GAT ATC GCT-3', antisense: 5'-ATG AGG TAG TCT GCT AGG T-3'. The polymerase...

Ngày tải lên: 11/08/2014, 08:21

... Primer IL-1RA ttggaaggctctgaacctca ctgaaggcttgcatcttgct SIGIRR ctcagagccatgccaggt cctcagcacctggtcttca 18sRNA gtaacccgttgaaccccatt ccatccaatcggtagtagcg Turner-Brannen et al. Arthritis Research & Therapy ... immunosorbent assay (ELISA), and various chemokines were evaluated by using multiplex cytometric bead array. Transcriptional responses were analyzed by quantitative real-time PCR. T...

Ngày tải lên: 12/08/2014, 17:22

... note, mAb 13H 5A5 did not detect Syncytin-1. However, a polyclonal rabbit anti- body (pAb) against Syncytin-1 readily recognized Syn- cytin-1 (Figure 2A, bottom panel). The anti-Syncytin-1 pAb, which ... with mAb 6A2 B2 on human placenta (A) and an acute MS lesion (B). Arrowheads in A point to syncytiotrophoblast cell layer. Strong staining with 6A2 B2 was seen in a case of fulminant MS...

Ngày tải lên: 13/08/2014, 01:20

... have very similar K d values for model viral and host DNA. Wild type IN and sIN both display a characteristic biphasic IN-DNA dissociation which is detected by SPR as a fast phase followed by ... HIV-1 Integrase by a C-terminal domain-specific monoclonal antibody* Joseph Ramcharan 1,2 , Diana M Colleluori 1,3 , George Merkel 1 , Mark D Andrake 1 and Anna Marie Skalka* 1 Addres...

Ngày tải lên: 13/08/2014, 09:20

... whose pharyngeal identity has already been specified by PHA-4 activity. Spatial and temporal patterning pathways may use similar mechanisms How universal is the model of combinatorial transcription control ... experimental strategy used by Mango and colleagues [8,9] to identify regulatory motifs that specify temporal and spatial patterns of gene expression during pharyngeal development. (...

Ngày tải lên: 14/08/2014, 14:21

... to adapt their metabolic capabilities in an optimal way to varying external conditions. Our approach consists in (a) establishing a mathematical model of the metabolic pathways under consideration, ... the case of a linear chain this becomes apparent by a lag phase before starting to synthesize the final product. For yeast metabo- lism global optimization of the survival time is achiev...

Ngày tải lên: 17/03/2014, 10:20

... Proc Natl Acad Sci USA 1992, 89:7375-7379. 7. Allen JB, Manthey CL, Hand AR, Ohura K, Ellingsworth L, Wahl SM: Rapid onset synovial inflammation and hyperplasia induced by transforming growth factor ... Tokuhisa T, Ra C, Iwamoto I: Blockade of transforming growth factor beta/Smad signaling in T cells by overexpression of Smad7 enhances antigen-induced airway inflammation and airway reacti...

Ngày tải lên: 09/08/2014, 01:23