Báo cáo y học: " Construction of a polycystic ovarian syndrome (PCOS) pathway based on the interactions of PCOS-related proteins retrieved from bibliomic data" docx
Báo cáo y học: " Construction of a polycystic ovarian syndrome (PCOS) pathway based on the interactions of PCOS-related proteins retrieved from bibliomic data" docx
... CentralPage 1 of 7(page number not for citation purposes)Theoretical Biology and Medical ModellingOpen AccessResearch Construction of a polycystic ovarian syndrome (PCOS) pathway based on the ... information on proteins related to PCOS, constructed a hypothetical net-work of interactions among PCOS-related proteins, andthen inferred the function of a hypothetical protein thatmay be ... Malaysia, 43600, UKM Bangi, Selangor, MalaysiaEmail: Zeti-Azura Mohamed-Hussein* - zeti@ukm.my; Sarahani Harun - hani.sarah@gmail.com* Corresponding author †Equal contributorsAbstractPolycystic...
- 7
- 358
- 0
Báo cáo y học: " Protein kinase A-dependent Neuronal Nitric Oxide Synthase Activation Mediates the Enhancement of Baroreflex Response by Adrenomedullin in the Nucleus Tractus Solitarii of Rats" pps
... interest wasnormalized against b-actin.Statistical analysisAll data are presented as mean ± S.E.M. Results wereanalyzed by one-way or two-way ANOVA with repeatedmeasures for group means, as appropriate, ... Spyer KM: Neural organization and control of the baroreceptor reflex. RevPhysiol Biochem Pharmacol 1981, 88:23-124.14. Ishizaka Y, Ishizaka Y, Tanaka M, Kitamura K, Kangawa K, Minamino N,Matsuo ... osphorylation at Ser847 can lead to the activation of nNOS [35]. Recently, Xu and Krukoffdemonstrated in an in vitro study that ADM significantl y stimulated NO production from primary rat hypothalamicneurons...
- 9
- 633
- 0
Báo cáo y học: " Treatment with a neutralizing anti-murine interleukin-17 antibody after the onset of coxsackievirus b3-induced viral myocarditis reduces myocardium inflammation" pdf
... sense:5’CACAGAAGGAGTGGCTAAGGACCA3’antisense:5’ACGCACTAGGTTTGCCGAGTAGA3’103 bpIL-17[GenBank:16171] sense: 5’GTCAATGCGGAGGGAAAG3’antisense: 5’CACGAAGCAGTTTGGGAC 3’349 bpTNF -a GenBank:21926]sense: ... inhibition mayresult from the induction of other pathways and repla-cing the initial IL-17 contribution. Thus, t he role of IL-17 inhibition in the treatment of inflammatory condi-tions remains ... sections revealed that IL-17 mAbattenuate the severity of myocarditis, verified by the decreased HW/BW, a relief of myocardial inflammat ion,and improved pathological score of heart sections. Allthe...
- 7
- 255
- 0
Báo cáo y học: "E-Predict: a computational strategy for species identification based on observed DNA microarray hybridization patterns" pot
... normalization and similaritymetric had greater impact on intrafamily than on interfamilyseparation. The best overall separation was determined bycalculating the product of the means of the intrafamily ... Pearson correlation as the similarity metric achieved the highest overall separation, producing a mean intrafamilyseparation of 0.69 (standard deviation 0.17) and a meaninterfamily separation ... submitted to the NCBI GEO database [27](accession GSE2228).Evaluation of normalization and similarity metric parametersFigure 2Evaluation of normalization and similarity metric parameters. A training...
- 14
- 331
- 0
Báo cáo y học: " Respiratory difficulty caused by an ectopic brain tissue mass in the neck of a two-month-old baby: a case report" ppsx
... inability to feed on initial evalua-tion. A physical examinati on revealed no gross craniofa-cial abnormalities; our patient was a healthy baby with a large (6 cm × 8 cm) palpable mass in the left ... the nasal cavity.Case presentation: We report a case of rare pure cystic heterotopic brain tissue in a two-month-old Caucasianbaby girl that presented as a large cystic neck mass and was confused ... that presentedas a large cystic neck mass and was confused with a cys-tic hygroma [12].Case presentation A two-month-old Caucasian baby wa s admitted to ourpediatric surgical ward because of...
- 3
- 347
- 0
Báo cáo Y học: Dietary bisphenol A prevents ovarian degeneration and bone loss in female mice lacking the aromatase gene (Cyp19 ) pptx
... obtained from Oriental Yeast (Tokyo, Japan). BPA and E2 were from Sigma-Aldrich. An ELISA kit for BPA was from TakedaPharmaceutical Co. Ltd. (Tokyo, Japan). All other chem-icals were of analytical ... dietary BPA on the ovaries of ArKO miceTo examine the effects of dietary BPA on the ovaries of ArKO mice, histological analysis was performed. Depletion of follicles and formation of hemorrhagic ... diet at5 weeks of age and sacrificed at 5 months of age forexamination. We repeated a series of the experiments andobtained essentially same results.Preparation and analysis of RNAUteri and...
- 9
- 404
- 0
Báo cáo y học: "κ Increased AP-1 and NF-κB activation and recruitment with the β combination of the proinflammatory cytokines IL-1β, tumor necrosis factor alpha and IL-17 in rheumatoid synoviocyte" ppt
... Hata K, Andoh A, Shimada M, Fujino S, Bamba S, Araki Y, OkunoT, Fujiyama Y, Bamba T: IL-17 stimulates inflammatoryresponses via NF-kappaB and MAP kinase pathways inhuman colonic myofibroblasts. ... concentrations, IL-1β induced a weak activation of Fra-1 and TNF-α induced an activation of FosB and Fra-1. The combination of these twocytokines at low concentrations induced the nucleartranslocation ... declared.AcknowledgementSupported in part by a grant from l’Association de Recherche sur laPolyarthrite.References1. Asahara H, Fujisawa K, Kobata T, Hasunuma T, Maeda T,Asanuma M, Ogawa...
- 9
- 414
- 0
Báo cáo y học: "Indoleamine 2,3-dioxygenase-expressing dendritic cells are involved in the generation of CD4+CD25+ regulatory T cells in Peyer''''s patches in an orally tolerized, collagen-induced arthritis mouse model" ppt
... the ankle to the tarsal bone,3 = moderate edema and erythema from the ankle to the tarsalbone, and 4 = edema and erythema from the ankle to the entireleg. The sum of the values from three legs, ... humanregulatory plasmacytoid DCs and can be induced by classicalDC maturation stimuli, namely IFNγ and lipopolysaccharide orprostaglandin E2, which contribute to their immunoregulatorycapacity ... MC, Alegre ML, Puccetti P: Modulation of tryptophan catabolism by regulatory T cells. Nat Immunol2003, 4:1206-1212.32. Yoshida R, Nukiwa T, Watanabe Y, Fujiwara M, Hirata F, Hayaishi O:Regulation...
- 10
- 473
- 0
Báo cáo y học: " High-mobility group box protein 1 (HMGB1): an alarmin mediating the pathogenesis of rheumatic disease." docx
... Yoshimoto Y, TanakaM, Uchimura T, Ida N, Yamazaki Y, Yamada S, Yamamoto Y, Yamamoto H, Iino S, Taniguchi N, Maruyama I: The N-terminaldomain of thrombomodulin sequesters high-mobility group-B1 ... the pathogenesis of a wide variety of inflammatory conditions andmay present a new target of therapy for RA and relatedrheumatic diseases. Future studies will define the pathwaysfor HMGB1 release in disease, ... proinflammatory mediators called alarmins. As a group,alarmins display distinct intracellular and extracellularactivities, with potent stimulation of the innate immune systemas their cardinal feature....
- 10
- 384
- 0
Báo cáo y học: " Non infective severe aortic paravalvular leakage 7 years after surgery: the role of suture technique" pot
... thromboembolic and hemolytic complications.After valve replacement the factors that may mainlyfavor PVL formation are the annulus calcification andinfections.We report a case of paraprosthetic l eakage, ... prosthetic valve imp lantation.An additional advantage of the continuous suture tech-niquemaybethepresenceoflessthrombogenicmate-rial (pledgettes) around the prosthesis [5]. The advantages of ... parapros-thetic regurgitation that needs a second intervention.ConclusionsDespite the annual aortic echoca rdiographic monitoringour patient had a sudden onset of dyspnea and a rapidcardiac...
- 3
- 321
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnon the flip of a coin the streets meaninga mention synchronous coreference resolution algorithm based on the bell treemovies based on the fountain of youthbáo cáo khoa học y họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ