Báo cáo y học: " Construction of a polycystic ovarian syndrome (PCOS) pathway based on the interactions of PCOS-related proteins retrieved from bibliomic data" docx
Báo cáo y học: " Construction of a polycystic ovarian syndrome (PCOS) pathway based on the interactions of PCOS-related proteins retrieved from bibliomic data" docx
... Central Page 1 of 7 (page number not for citation purposes) Theoretical Biology and Medical Modelling Open Access Research Construction of a polycystic ovarian syndrome (PCOS) pathway based on the ... information on proteins related to PCOS, constructed a hypothetical net- work of interactions among PCOS-related proteins, and then inferred the functio...
Ngày tải lên: 13/08/2014, 16:20
Báo cáo y học: " Protein kinase A-dependent Neuronal Nitric Oxide Synthase Activation Mediates the Enhancement of Baroreflex Response by Adrenomedullin in the Nucleus Tractus Solitarii of Rats" pps
... interest was normalized against b-actin. Statistical analysis All data are presented as mean ± S.E.M. Results were analyzed by one-way or two-way ANOVA with repeated measures for group means, as appropriate, ... Spyer KM: Neural organization and control of the baroreceptor reflex. Rev Physiol Biochem Pharmacol 1981, 88:23-124. 14. Ishizaka Y, Ishizaka Y, Tanaka M, Kitamura K, Kangawa K,...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: " Treatment with a neutralizing anti-murine interleukin-17 antibody after the onset of coxsackievirus b3-induced viral myocarditis reduces myocardium inflammation" pdf
... sense: 5’CACAGAAGGAGTGGCTAAGGACCA3’ antisense: 5’ACGCACTAGGTTTGCCGAGTAGA3’ 103 bp IL-17[GenBank:16171] sense: 5’GTCAATGCGGAGGGAAAG3’ antisense: 5’CACGAAGCAGTTTGGGAC 3’ 349 bp TNF -a GenBank:21926] sense: ... inhibition may result from the induction of other pathways and repla- cing the initial IL-17 contribution. Thus, t he role of IL-17 inhibition in the treatment of inflammat...
Ngày tải lên: 11/08/2014, 21:21
Báo cáo y học: "E-Predict: a computational strategy for species identification based on observed DNA microarray hybridization patterns" pot
... normalization and similarity metric had greater impact on intrafamily than on interfamily separation. The best overall separation was determined by calculating the product of the means of the intrafamily ... Pearson correlation as the similarity metric achieved the highest overall separation, producing a mean intrafamily separation of 0.69 (standard deviation 0.17) and...
Ngày tải lên: 14/08/2014, 14:22
Báo cáo y học: " Respiratory difficulty caused by an ectopic brain tissue mass in the neck of a two-month-old baby: a case report" ppsx
... inability to feed on initial evalua- tion. A physical examinati on revealed no gross craniofa- cial abnormalities; our patient was a healthy baby with a large (6 cm × 8 cm) palpable mass in the left ... the nasal cavity. Case presentation: We report a case of rare pure cystic heterotopic brain tissue in a two-month-old Caucasian baby girl that presented as a large cystic...
Ngày tải lên: 10/08/2014, 23:21
Báo cáo Y học: Dietary bisphenol A prevents ovarian degeneration and bone loss in female mice lacking the aromatase gene (Cyp19 ) pptx
... obtained from Oriental Yeast (Tokyo, Japan). BPA and E2 were from Sigma-Aldrich. An ELISA kit for BPA was from Takeda Pharmaceutical Co. Ltd. (Tokyo, Japan). All other chem- icals were of analytical ... dietary BPA on the ovaries of ArKO mice To examine the effects of dietary BPA on the ovaries of ArKO mice, histological analysis was performed. Depletion of follicles...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo y học: "κ Increased AP-1 and NF-κB activation and recruitment with the β combination of the proinflammatory cytokines IL-1β, tumor necrosis factor alpha and IL-17 in rheumatoid synoviocyte" ppt
... Hata K, Andoh A, Shimada M, Fujino S, Bamba S, Araki Y, Okuno T, Fujiyama Y, Bamba T: IL-17 stimulates inflammatory responses via NF-kappaB and MAP kinase pathways in human colonic myofibroblasts. ... concentrations, IL-1β induced a weak activation of Fra-1 and TNF-α induced an activation of FosB and Fra-1. The combination of these two cytokines at low concentrations induced the...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "Indoleamine 2,3-dioxygenase-expressing dendritic cells are involved in the generation of CD4+CD25+ regulatory T cells in Peyer''''s patches in an orally tolerized, collagen-induced arthritis mouse model" ppt
... the ankle to the tarsal bone, 3 = moderate edema and erythema from the ankle to the tarsal bone, and 4 = edema and erythema from the ankle to the entire leg. The sum of the values from three legs, ... human regulatory plasmacytoid DCs and can be induced by classical DC maturation stimuli, namely IFNγ and lipopolysaccharide or prostaglandin E 2 , which contribute to the...
Ngày tải lên: 09/08/2014, 10:22
Báo cáo y học: " High-mobility group box protein 1 (HMGB1): an alarmin mediating the pathogenesis of rheumatic disease." docx
... Yoshimoto Y, Tanaka M, Uchimura T, Ida N, Yamazaki Y, Yamada S, Yamamoto Y, Yamamoto H, Iino S, Taniguchi N, Maruyama I: The N-terminal domain of thrombomodulin sequesters high-mobility group- B1 ... the pathogenesis of a wide variety of inflammatory conditions and may present a new target of therapy for RA and related rheumatic diseases. Future studies will define the p...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: " Non infective severe aortic paravalvular leakage 7 years after surgery: the role of suture technique" pot
... thromboembolic and hemolytic complications. After valve replacement the factors that may mainly favor PVL formation are the annulus calcification and infections. We report a case of paraprosthetic l eakage, ... prosthetic valve imp lantation. An additional advantage of the continuous suture tech- niquemaybethepresenceoflessthrombogenicmate- rial (pledgettes) around the prosthesi...
Ngày tải lên: 10/08/2014, 09:21