Báo cáo y học: "Effects of interventional lung assist on haemodynamics and gas exchange in cardiopulmonary resuscitation: a prospective experimental study on animals with acute respiratory distress syndrome" pdf
... effects of CPR on circulation and gas exchange with or without an ILA device operating in animals with ARDS. Before initiation of resuscitation all animals had a severe ARDS and a stable haemodynamic ... the analysis and interpretation of the data and revised the manuscript. NW conceived the study and participated in the design of the study, analysis...
Ngày tải lên: 13/08/2014, 15:21
... present study. In addition to the MAPK pathway, the Akt/PI-3 kinase pathway may play an important role in CSC- induced epithelial cell proliferation. Finally, a stimulatory effect of aged suspended ... Linnoila IR, Yang X, Swain SM, Harris C, Belinsky S, Dennis PA: Rapid Akt activation by nicotine and a tobacco carcinogen modulates the phenotype of normal human airway epithelia...
Ngày tải lên: 12/08/2014, 18:20
... mortality was 20% (61 patients) and one-year mortality was 41% (128 patients). Risk factors of one-year and in- hospital mortality Univariate analysis demonstrates that age, a history of CAD or malignancy, ... time of acute respiratory failure had consistently lower in- hospital and one-year overall mortality. Accordingly, the impact of b eta-blocker therapy on in- h...
Ngày tải lên: 13/08/2014, 21:21
Báo cáo y học: " Effects of CYP2B6 G516T polymorphisms on plasma efavirenz and nevirapine levels when co-administered with rifampicin in HIV/TB co-infected Thai adults" ppt
... Kumar AK, Jagan I, Vasantha M, Padmapriyadarsini C, Narendran G, Rajasekaran S, Swaminathan S: Association of high T allele frequency of CYP2B6 G516T polymorphism among ethnic south Indian HIV-infected ... n BioSciences, USA) and analyzed by FACScan flo w cytometer (Becton Dickinson BioSciences, USA.). Plasma HIV-1 RNA was determined by RT-PCR at baseline and every 12 weeks after init...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Effects of evening light conditions on salivary melatonin of Japanese junior high school students" ppsx
... the early morning and then decreases again rap- idly to the extremely low concentration typical of the daytime [7,8]. The increase in melatonin concentration might occur in late evening and trigger ... rhythm and sleep-wake cycle. Effects of light condition on salivary melatonin concentrationFigure 1 Effects of light condition on salivary melatonin concentration. Values sh...
Ngày tải lên: 10/08/2014, 09:20
Báo cáo y học: "Validation of actigraphy to assess circadian organization and sleep quality in patients with advanced lung cancer" potx
... polysomnography to objectively measure many standard sleep quality and quantity parameters as well as daily activity of healthy individuals [11-15]. Care has been taken to fully specify the instrumentation ... Millenium and Action W2 software (Ambulatory Monitoring, Inc). Rhythmometric analysis (using Chronolab v2) was done on these sleep/activity patterns in order to assess d isrup...
Ngày tải lên: 10/08/2014, 09:20
Báo cáo y học: " Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts" pdf
... 8:25 http://www.journal-inflammation.com/content/8/1/25 Page 7 of 7 RESEARCH Open Access Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts Linn a Asp 1 , ... encoding indoleamine 2,3-dioxygenase, kynureninase or 3-hydroxyanthranilic acid oxygenase and decreases in the levels of transcripts encoding tryptophan 2,3-dio...
Ngày tải lên: 11/08/2014, 03:20
Báo cáo y học: "Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts" pot
... Sense CACATCTGGCAGCCAACAAG Anti-sense CACTGGCAACATTAATAATGTTGCA KAT3 CCBL2 Sense ACTATCAGCCATCCCCGTTTC Anti-sense AATGAAGCAAAAACGCACAAACT KAT4 GOT2 Sense TGTGGTGTGCAGCCTCTCAT Anti-sense AAGCCTGAACCCAGCTAGCA KYNU ... CTAGTAGATGCCCACTGAATATTTGTG HAAO HAAO Sense GGACGTTCTGTTTGAGAAGTGGTT Anti-sense AGCTGAAGAACTCCTGGATGATG KAT1 CCBL1 Sense CCTGCTAAGGCTCAGGTATAACCT Anti-sense GGACTCAAGCCTAAAGGCAACT...
Ngày tải lên: 11/08/2014, 06:23
Báo cáo y học: " Effects of supplemental fish oil on resting metabolic rate, body composition, and salivary cortisol in healthy adults" ppsx
... Kobayashi H, Ashakumary L, Rouyer IA, Takahashi Y, Aoyama T, Hashimoto T, Mizugaki M: Comparative effects of perilla and fish oils on the activity and gene expression of fatty acid oxidation ... collection, statistical analysis and manuscript preparation. MJS, MLC, VAP and LKA contributed in the design of the study, data collection, and manuscript preparation. JB contrib...
Ngày tải lên: 11/08/2014, 23:21
Báo cáo y học: " Effects of carbohydrate, branched-chain amino acids, and arginine in recovery period on the subsequent performance in wrestlers" potx
... muscle and further increase glycogen recovery [13]. BCAA and arginine may also facilitate the insulin-dependent phase by inducing insulin secretion [14, 15]. The consumption of leucine and arginine ... this study suggested that consumption of carbohydrate or carbohydrate plus BCAA and arginine 14 CHO and CHO+AA trials. The supplementation of CHO and CHO+AA resulted...
Ngày tải lên: 11/08/2014, 23:21