Báo cáo y học: " Effects of tender point acupuncture on delayed onset muscle soreness (DOMS) – a pragmatic trial " potx
Báo cáo y học: " Effects of tender point acupuncture on delayed onset muscle soreness (DOMS) – a pragmatic trial." potx
... acupuncture stimulation of tender points may activate sensitized polymodal-type receptors thereby relieving pain. In clinical practice, acupuncture treatment may be effective on myofascial pain ... Central Page 1 of 5 (page number not for citation purposes) Chinese Medicine Open Access Research Effects of tender point acupuncture on delayed onset muscle soreness...
Ngày tải lên: 13/08/2014, 15:21
Báo cáo y học: " Effects of CYP2B6 G516T polymorphisms on plasma efavirenz and nevirapine levels when co-administered with rifampicin in HIV/TB co-infected Thai adults" ppt
... Gatanaga H, Hayashida T, Tsuchiya K, Yoshino M, Kuwahara T, Tsukada H, Fujimoto K, Sato I, Ueda M, Horiba M, Hamaguchi M, Yamamoto M, Takata N, Kimura A, Koike T, Gejyo F, Matsushita S, Shirasaka ... Anekthananon T, Burapat C, Akksilp S, Mankhatitham W, Srinak C, Nateniyom S, Sattayawuthipong W, Tasaneeyapan T, Varma JK: Causes of death in HIV-infected persons who have tuberculosis, Thaila...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Effects of evening light conditions on salivary melatonin of Japanese junior high school students" ppsx
... rhythm and sleep-wake cycle. Effects of light condition on salivary melatonin concentrationFigure 1 Effects of light condition on salivary melatonin concentration. Values shown are means (n = ... conditions on salivary melatonin of Japanese junior high school students Tetsuo Harada* Address: Laboratory of Environmental Physiology, Faculty of Education, Kochi University, K...
Ngày tải lên: 10/08/2014, 09:20
Báo cáo y học: " Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts" pdf
... Reduction of endogenous kynurenic acid formation enhances extracellular glutamate, hippocampal plasticity, and cognitive behavior. Neuropsychopharmacology 35(8):1734-1742. 17. Laugeray A, Launay JM, ... this article as: Asp et al.: Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts. Journal of Inflammation 2011 8:25. Subm...
Ngày tải lên: 11/08/2014, 03:20
Báo cáo y học: "Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts" pot
... GGACGTTCTGTTTGAGAAGTGGTT Anti-sense AGCTGAAGAACTCCTGGATGATG KAT1 CCBL1 Sense CCTGCTAAGGCTCAGGTATAACCT Anti-sense GGACTCAAGCCTAAAGGCAACTC KAT2 AADAT Sense CACATCTGGCAGCCAACAAG Anti-sense CACTGGCAACATTAATAATGTTGCA KAT3 CCBL2 ... Sense GAACATCTTTTTATCATAACTCATCAAGCT Anti-sense ACAACCTTAAGCATGTTCCTTTCAT KMO KMO Sense TGTAATCCTCCAAGCTTCAATCTG Anti-sense CTAGTAGATGCCCACTGAATATTTGTG HAAO HAAO Sense...
Ngày tải lên: 11/08/2014, 06:23
Báo cáo y học: " Effects of supplemental fish oil on resting metabolic rate, body composition, and salivary cortisol in healthy adults" ppsx
... Kobayashi H, Ashakumary L, Rouyer IA, Takahashi Y, Aoyama T, Hashimoto T, Mizugaki M: Comparative effects of perilla and fish oils on the activity and gene expression of fatty acid oxidation ... and manuscript preparation. JB contributed with data analysis, statistical analysis, and manuscript preparation. All authors have read and approved the final draft of this manuscript. Ackno...
Ngày tải lên: 11/08/2014, 23:21
Báo cáo y học: "Effects of lifestyle physical activity on perceived symptoms and physical function in adults with fibromyalgia: results of a randomized trial" pdf
... Fibromyalgia Impact Questionnaire; FM: fibromyalgia; FME: Fibromyalgia Education Control Group; FSS: Fatigue Severity Scale; LPA: lifestyle physical activity; SD: standard deviation; VAS: Visual Analogue ... hampers day-to-day functioning and is a primary cause of disability [5]. Even with the recent Food and Drug Administration approval of medications to treat FM, pharmacotherapy gener...
Ngày tải lên: 12/08/2014, 12:20
Báo cáo y học: " Effects of cigarette smoke condensate on proliferation and wound closure of bronchial epithelial cells in vitro: role of glutathione" pdf
... present study. In addition to the MAPK pathway, the Akt/PI-3 kinase pathway may play an important role in CSC- induced epithelial cell proliferation. Finally, a stimulatory effect of aged suspended ... Cavallesco G, Papi A, Fabbri LM: Goblet cell hyperplasia and epithelial inflammation in peripheral airways of smokers with both symptoms of chronic bronchitis and chronic air- flow lim...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo y học: "Effects of redox cycling compounds on DT diaphorase activity in the liver of rainbow trout (Oncorhynchus mykiss)" doc
... M -1 cm -1 ). Protein content was determined using the BCA Protein Assay Kit (Pierce, USA), with BSA as standard. Statistical analysis Data were analyzed with one-way analysis of variance (ANOVA) and, following ... Kg -1 ) also caused increased DTD activity after 5 days (Table 1). Among the monofunctional inducers studied MN was the only one to cause a significant increase in DTD activity...
Ngày tải lên: 13/08/2014, 13:20
Báo cáo y học: "Effects of interventional lung assist on haemodynamics and gas exchange in cardiopulmonary resuscitation: a prospective experimental study on animals with acute respiratory distress syndrome" pdf
... effects of CPR on circulation and gas exchange with or without an ILA device operating in animals with ARDS. Before initiation of resuscitation all animals had a severe ARDS and a stable haemodynamic ... the analysis and interpretation of the data and revised the manuscript. NW conceived the study and participated in the design of the study, analysis and interpretation of da...
Ngày tải lên: 13/08/2014, 15:21