Báo cáo y học: " Green tea (Camellia sinensis) and cancer prevention: a systematic review of randomized trials and epidemiological studies" ppt

Báo cáo y học: " Green tea (Camellia sinensis) and cancer prevention: a systematic review of randomized trials and epidemiological studies" ppt

Báo cáo y học: " Green tea (Camellia sinensis) and cancer prevention: a systematic review of randomized trials and epidemiological studies" ppt

... Hoshiyama Y, Kawaguchi T, Miura Y, Mizoue T, Tokui N, Yatsuya H, Sakata K, Kondo T, Kikuchi S, Toyoshima H, Hayakawa N, Tamakoshi A, Ohno Y, Yoshimura T: A prospective study of stomach can- cer ... Access Review Green tea (Camellia sinensis) and cancer prevention: a systematic review of randomized trials and epidemiological studies Jianping Liu* 1,2,3...

Ngày tải lên: 13/08/2014, 15:21

7 296 0
Báo cáo y học: "Green tea polyphenol extract attenuates lung injury in experimental model of carrageenan-induced pleurisy in mice" ppt

Báo cáo y học: "Green tea polyphenol extract attenuates lung injury in experimental model of carrageenan-induced pleurisy in mice" ppt

... STAT-1. Signal transducers and activators of transcription (STAT) factors are a family of cytoplasmic transcription factors that mediate intracellular signaling initiated at cytokine cell surface ... such as glutathione, ascorbic acid, and alpha-tocopherol are scavengers of peroxynitrite and inhibitors of its oxidant capacity [17,18]. Green tea – a minimally processed pr...

Ngày tải lên: 12/08/2014, 18:21

13 355 0
Báo cáo y học: "Diagnostic imaging for chronic plantar heel pain: a systematic review and meta-analysis" ppsx

Báo cáo y học: "Diagnostic imaging for chronic plantar heel pain: a systematic review and meta-analysis" ppsx

... Methodological quality was evaluated by use of the Quality Index as described by Downs and Black. Meta-analysis of study data was conducted where appropriate. Results: Plantar fascia thickness as measured ... study [31] reported data separately for the medial, central and lateral compo- nents of the plantar fascia, and another study [30] did not report the standard deviation of...

Ngày tải lên: 10/08/2014, 21:24

11 362 0
báo cáo hóa học: " Type D personality in the general population: a systematic review of health status, mechanisms of disease, and work-related problems" docx

báo cáo hóa học: " Type D personality in the general population: a systematic review of health status, mechanisms of disease, and work-related problems" docx

... the general population. Type D personality and mechanisms of disease Six studies examined behavioral and biological mechan- isms of disease as a function of Type D personality in apparently health ... nega- tive affectivity was related to dampened heart rate reactivity [11]. Type D was also associated with a differ- ential activity of the amygdala in react ion to fearful ver-...

Ngày tải lên: 18/06/2014, 19:20

10 595 0
Báo cáo y học: "Green tea polyphenol epigallocatechin-3-gallate inhibits advanced glycation end product-induced expression of tumor necrosis factor-α and matrix metalloproteinase-13 in human chondrocyte" ppsx

Báo cáo y học: "Green tea polyphenol epigallocatechin-3-gallate inhibits advanced glycation end product-induced expression of tumor necrosis factor-α and matrix metalloproteinase-13 in human chondrocyte" ppsx

... (COL1 0A1 ), aggrecan (ACAN), and SRY- box containing gene 9 (SOX-9), total cellular RNA was pre- pared using a commercially available kit (Qiagen, Valencia, CA, USA). First-strand cDNA was synthesized ... ATC CAA CCT TCC CAA-3'; reverse, 5'-TTT GAG CCA GAA GAG GTT GAG GGT-3'), MMP-13 (NM_002427: forward, 5'-CGC CAG AAG AAT CTG TCT TTA AA-3'; reverse, 5'-CCA...

Ngày tải lên: 09/08/2014, 14:20

13 401 0
Báo cáo y học: "Green tea increases anti-inflammatory tristetraprolin and decreases pro-inflammatory tumor necrosis factor mRNA levels in rats" pdf

Báo cáo y học: "Green tea increases anti-inflammatory tristetraprolin and decreases pro-inflammatory tumor necrosis factor mRNA levels in rats" pdf

... TCACCCGGCCTTGGAAGCATGTAGA GGAGGCTCAGAGCTTCTTTGA Elavl1/Hua/Hur NM_010485 69 bp CCTCCGAGCCCATCACAGT AAGTTTGCAGCCAATCCCAACCAGAA GCGAGAGGAGAGCCATGTTT Vegfa NM_001025250 68 bp CAAAAACGAAAGCGCAAGAAA CCCGGTTTAAATCCTGGAGCG ... CCCGGTTTAAATCCTGGAGCG CGCTCTGAACAAGGCTCACA Vegfb NM_011697 83 bp GATCCAGTACCCGAGCAGTCA TGTCCCTGGAAGAACACAGCCAATGTG TCTCCTTTTTTTTTGGTCTGCAT Rpl32 NM_172086 66 bp AACCGAAAAGCCAT...

Ngày tải lên: 11/08/2014, 08:21

12 327 0
Báo cáo y học: "Green tea polyphenol epigallocatechin 3-gallate in arthritis: progress and promise" pdf

Báo cáo y học: "Green tea polyphenol epigallocatechin 3-gallate in arthritis: progress and promise" pdf

... degradation of human cartilage proteoglycan and type II collagen, and selectively inhibited ADAMTS-1, ADAMTS-4, and ADAMTS-5 [22,23]. Further evaluation of the eff ect of Ahmed Arthritis Research ... Hakim IA, Crowell JA, Shahi F, Brooks CA, Dorr RT, Hara Y, Alberts DS: Pharmacokinetics and safety of green tea polyphenols after multiple-dose administration of epiga...

Ngày tải lên: 12/08/2014, 12:20

9 275 0
Báo cáo y học: "Green tea: a new option for the prevention or control of osteoarthritis" ppt

Báo cáo y học: "Green tea: a new option for the prevention or control of osteoarthritis" ppt

... general, and of EGCG in particular, in arthritic/OA animal models.  e use of GTPs may be better than EGCG as GTPs may have synergistic eff ects, are more stable and are easily a ordable. It may also ... Ahmed S, Rahman A, Hasnain A, Lalonde M, Goldberg VM, Haqqi TM: Green tea polyphenol epigallocatechin-3-gallate inhibits the IL-1β-induced activity and expression of cy...

Ngày tải lên: 12/08/2014, 17:22

2 338 0
Báo cáo y học: "Electronic patient record use during ward rounds: a qualitative study of interaction between medical staff"

Báo cáo y học: "Electronic patient record use during ward rounds: a qualitative study of interaction between medical staff"

... conversation rather than the data, as described above, and the use of paper to provide relevant data – are not surprising in that they address the issues of access to data and a need to stimulate ... provided a clear indication of one's desire to speak, and this was usually granted by the consultant reorient- ing towards that person. Another way of starting the conversa...

Ngày tải lên: 25/10/2012, 10:31

8 503 0
Báo cáo Y học: Conformationally constrained human calcitonin (hCt) analogues reveal a critical role of sequence 17–21 for the oligomerization state and bioactivity of hCt ppt

Báo cáo Y học: Conformationally constrained human calcitonin (hCt) analogues reveal a critical role of sequence 17–21 for the oligomerization state and bioactivity of hCt ppt

... of salmon calcitonin. Biopolymers 31, 233–241. 18. K atahira, R., Doi, M., Kyogoku, Y. , Yamada-Nosaka, A. , Yamasaki, K., Takai, M. & Kobayashi, Y. (1995) Solution structure o f a human calcitonin ... with a Kratos Compact MALDI I (Shimadzu Europe, D uisburg, Germany) and a- cyano-4-hydroxycinnamic acid as matrix. Purity of the HPLC purified peptides were also confirmed by an...

Ngày tải lên: 31/03/2014, 21:21

12 448 0
w