Báo cáo y học: " Chemical fingerprinting and quantitative analysis of a Panax notoginseng preparation using HPLC-UV and HPLC-MS" pdf
Báo cáo y học: " Chemical fingerprinting and quantitative analysis of a Panax notoginseng preparation using HPLC-UV and HPLC-MS" pdf
... RESEARCH Open Access Chemical fingerprinting and quantitative analysis of a Panax notoginseng preparation using HPLC-UV and HPLC-MS Hong Yao, Peiying Shi, Qing Shao, Xiaohui Fan * Abstract Background: ... ion spray voltage, -4.5 kV; sheath gas (N 2 ) at a flow rate of 60 arbitrary units; auxiliary gas (N 2 ) at a flow rate of 20 arbitrary units; capillary tem...
Ngày tải lên: 13/08/2014, 14:20
Tài liệu Báo cáo Y học: The RuvABC resolvasome Quantitative analysis of RuvA and RuvC assembly on junction DNA doc
... TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCC HJ8 CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGA HJ1 AGAAGCTCCATGTAGCAAGGCTAG HJ2 CTAGCCTTGCTAGGACATCTTCCG HJ3 CGGAAGATGTCCATCTGTTGTAGG HJ4 Bio-AAAAAACCTACAACAGATCATGGAGCTTCT 5498 ... Bio-GTACGAGCAGCTCCCGGGTCAGTCTGCCTA DU2 TAGGCAGACTGACCCGGGAGCTGCTCGTAC HJ5 Bio-AAAAATGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTT HJ6 GTCGGATCCTCTAGAC...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo Y học: Novel fish hypothalamic neuropeptide Cloning of a cDNA encoding the precursor polypeptide and identification and localization of the mature peptide pptx
... Matsumoto, Y. , Hosoya, M., Fujii, R., Watanabe, T., Kikuchi, K., Terao, Y. , Yano, T., Yamamoto, T., Kawamata, Y. , Habata, Y. , Asada, M., Kitada, C., Kurokawa, T., Onda, H., Nishimura, O., Tanaka, M., ... Fukusumi, S., Habata, Y. , Yoshida, H., Iijima, N., Kawamata, Y. , Hosoya, M., Fujii, R., Hinuma, S., Kitada, C., Shintani, Y. , Suenaga, M., Onda, H., Nishimura, O., Tanaka, M., I...
Ngày tải lên: 08/03/2014, 16:20
Báo cáo y học: " Research Transperineal prostate biopsy: analysis of a uniform core sampling pattern that yields data on tumor volume limits in negative biopsies" pdf
... Patriciu A, Tanacs A, Mazilu D, Anderson JH, Masamune K, Taylor AH, Stoianovici D: System for robotically assisted prostate biopsy and therapy with intraoperative guidance. Acad Radiol 2002, ... ability to extract, via direct mathematical analysis, quantitative information on potential tumor volumes from a transperineal biopsy that gives a negative result expands Figure 4 Probabil...
Ngày tải lên: 13/08/2014, 16:20
Báo cáo y học: "Cellular mechanisms underlying the effects of an early experience on cognitive abilities and affective states." ppt
... a chronic forced swimming stress, were measured by radioimmunoassay (RIA). Data were statistically analyzed by analysis of variance (ANOVA). Results: Neonatal handling increased the ability of ... participated in the statistical analysis of the data as well as to draft the manuscript. All authors read and approved the final manuscript. Acknowledgements This research was supporte...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "Chemical restraint in routine clinical practice: a report from a general hospital psychiatric ward in Greece" ppsx
... in Psychiatry and Psychotherapy Darmstadt, Germany: Steinkopff; 2009, [in German]. 10. Keski-Valkama A, Sailas E, Eronen M, Koivisto AM, Lonnqvist J, Kaltiala- Heino R: A 15-year national follow-up. ... Practice, Ioannina, Greece Full list of author information is available at the end of the article Bilanakis et al. Annals of General Psychiatry 2011, 10:4 http://www.annals-general-...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "The triterpenoid CDDO inhibits expression of matrix metalloproteinase-1, matrix metalloproteinase-13 and Bcl-3 in primary human chondrocytes" ppt
... SW- 1353 cells and in two primary cultures: human primary chondrocytes and OA synovial fibroblasts. We have shown in a quantitative manner that in all three cell types, MMP-1 and MMP-13 are inducible ... biochemical and physical stimuli to maintain this tissue. Cartilage is primarily composed of type II collagen and proteoglycan, which are synthesized by the chondrocytes. In a...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "Reactive oxygen species induce expression of vascular endothelial growth factor in chondrocytes and human articular cartilage explants" pps
... cycles performed at a 55°C annealing temperature. A glyceralde- hyde-3-phosphate-dehydrogenase (G3PDH)-specific primer pair (5'-ATC-AAG-AAG-GTG-GTG-AAG-CAGG-3' (sense) and 5'-TGA-GTG-TCG-CTG-TTG-AAG-TCG-3' ... the participation of free radicals in the pathogenesis of articular cartilage degradation [12]. Free radicals are highly reactive in oxidative processes a...
Ngày tải lên: 09/08/2014, 08:23
Báo cáo y học: " De novo genome sequence assembly of a filamentous fungus using Sanger, 454 and Illumina sequence data" ppsx
... description and annotation of the Gc genome will be published separately (manuscript in preparation) . Analysis of Illumina and 454 read data We used the manually finished GCgb1 assembly to assess ... assembly is approximately 32.5 Mb in length and has an N50 scaffold size of approximately 782 kb. The assembly as well as the raw read data are available from National Center for...
Ngày tải lên: 09/08/2014, 20:20
Báo cáo y học: " MM-ChIP enables integrative analysis of cross-platform and between-laboratory ChIP-chip or ChIP-seq data" doc
... and ChIP-seq data. MA2C, Model-based Analysis of 2-Color Arrays; MACS, Model-based Analysis of ChIP-Seq data; MAT, Model-based Analysis of Tiling-array. Chen et al. Genome Biology 2011, 12:R11 http://genomebiology.com/content/12/2/R11 Page ... data. An inte- grat ive analysis was performed on each pair of common library and variant library data (Δd = 0, 100, 200) to evalua...
Ngày tải lên: 09/08/2014, 22:23