Báo cáo y học: "Are chiropractors in the uk primary healthcare or primary contact practitioners?: a mixed methods study" docx

Báo cáo y học: "Are chiropractors in the uk primary healthcare or primary contact practitioners?: a mixed methods study" docx

Báo cáo y học: "Are chiropractors in the uk primary healthcare or primary contact practitioners?: a mixed methods study" docx

... primary healthcare or primary contact practitioners?: a mixed methods study Amanda R Jones-Harris Abstract Background: One of the debates regard ing the role of chiropractors is whether or not they ... chiropractors as primary healthcare practitioners, each pertaining to a different aspect of primary healthcare .Therespon- dents were in agreement that when...

Ngày tải lên: 13/08/2014, 14:20

12 523 0
Báo cáo y học: "Inflammatory changes in the airways of mice caused by cigarette smoke exposure are only partially reversed after smoking cessation" docx

Báo cáo y học: "Inflammatory changes in the airways of mice caused by cigarette smoke exposure are only partially reversed after smoking cessation" docx

... emphysema, included determination of the averag e inter-alveolar distance, was estimated by the mean linear intercept (Lm) analysis. The Lm was determined by light microscopy at a total magnification ... to investigate the effect of smoking cessation on airway remodeling and pulmonary inflammation. The severity of airway remo- deling and inflammation was studied by determining alv...

Ngày tải lên: 12/08/2014, 11:22

11 432 0
Báo cáo y học: "Structural features in the Rous sarcoma virus RNA stability element are necessary for sensing the correct termination codon" potx

Báo cáo y học: "Structural features in the Rous sarcoma virus RNA stability element are necessary for sensing the correct termination codon" potx

... CGAAACTAGTCCCTCNCTA- TAAATTTGTC AAGCGG PTC at 1250 AatII UAGN for CGCATGACGTCTAGNATCTAA TGAGAG EagI UAGG rev CGAACGGCCGCCCTCGCTAT AAATTTGTCAAGCGG Premature termination codons were introduced into ... GTGGCCCCTCCCT[TAGG] GTAAACTTGTAGCGCTAACGC QCPTC2631 CGCAATTAGTGGAAAAAGAATTA [TAGG] TAGGACATATAGAACCTTCACTTAGTTGTTGG QCPTC2685 GAACACACCTGTCTTCGTG[TAGG] GGAAGGCTTCCGGG QCPTC2736 CATGATTTGCGCGCTGTT...

Ngày tải lên: 13/08/2014, 01:20

15 396 0
Báo cáo y học: " Processing sites in the human immunodeficiency virus type 1 (HIV-1) Gag-Pro-Pol precursor are cleaved by the viral protease at different rates" ppt

Báo cáo y học: " Processing sites in the human immunodeficiency virus type 1 (HIV-1) Gag-Pro-Pol precursor are cleaved by the viral protease at different rates" ppt

... pi120, appeared initially at the 2 minute time point showing that RH /IN and RT/RH cleavage occur relatively early in the processing cascade. The later and BioMed Central Page 1 of 6 (page number ... cleaved at rates that vary up to 400- fold in vitro [9,13]. Initial cleavage occurs at the p2/NC site followed by an intermediate rate of cleavage at the MA/CA and p1/p6 sites, and...

Ngày tải lên: 13/08/2014, 09:21

6 353 0
Báo cáo y học: "Special considerations in the treatment of patients with bipolar disorder and medical co-morbidities"

Báo cáo y học: "Special considerations in the treatment of patients with bipolar disorder and medical co-morbidities"

... with advanced cancer and pain. J Pain Symptom Manage 2002, 23:526-532. 83. Khojainova N, Santiago-Palma J, Kornick C, Breitbart W, Gonzales GR: Olanzapine in the management of cancer pain. J Pain Symptom ... anticoagulant and cardiovascular medications. Olanzapine may induce or worsen cardiac risk factors such as obesity, metabolic derangements and hyperlipidemia. Quetiapine and risperi...

Ngày tải lên: 25/10/2012, 10:51

10 710 0
Báo cáo y học: "Genetic polymorphisms in the nucleotide excision repair pathway and lung cancer risk: A meta-analysis"

Báo cáo y học: "Genetic polymorphisms in the nucleotide excision repair pathway and lung cancer risk: A meta-analysis"

... that are capable of inducing muta- tions and initiating carcinogenesis. The capacity to repair DNA damage induced by activated carcinogens appears to be one of the host factors that may influ- ence ... may be always a possible limitation of combining data from various sources as in a meta-analysis. The idea of ad- justing the results of meta-analyses for publication bias an...

Ngày tải lên: 31/10/2012, 14:59

13 712 0
Báo cáo Y học: Expression pattern in the antennae of a newly isolated lepidopteran Gq protein a subunit cDNA potx

Báo cáo Y học: Expression pattern in the antennae of a newly isolated lepidopteran Gq protein a subunit cDNA potx

... After its activation, different secondary pathways can occur: adenylate cyclase catalyses the formation of cAMP, whereas phospholipase C hydrolyses membrane phospha- tidylinositol, liberating inositol ... 1,4,5-triphosphate (InsP 3 ) and diacylglycerol. Although cAMP and InsP 3 cascades appear to be active as two alternative pathways in vertebrate olfaction [7], mechanisms of olfactory si...

Ngày tải lên: 17/03/2014, 23:20

10 619 0
Báo cáo y học: "Treating rhinitis in the older population: special considerations" pdf

Báo cáo y học: "Treating rhinitis in the older population: special considerations" pdf

... rhinitis may be caused on rare occasions by organisms such as Klebsiella ozaenae. Secondary atrophic rhinitis may result from nasal surgery, particu- larly from turbinectomy performed for nasal ... at reconstituting support for the nasal upper lateral cartilage and elevating the drooping nasal tip. Removal of tur- binate mucosa should be avoided, especially when exces- sive dryness is alr...

Ngày tải lên: 08/08/2014, 21:20

4 465 0
Báo cáo y học: "Physical anhedonia in the acute phase of schizophrenia" doc

Báo cáo y học: "Physical anhedonia in the acute phase of schizophrenia" doc

... a "cardinal symptom" preceding and possibly causing schizophrenia. According to Chapman et al [7], there are two types of anhedonia, physical anhedonia and social anhedonia. Physical ... Physical Anhedonia Scale, PANSS: Positive and Negative Syndrome Scale, EPSE: Rating Scale for Extrapyramidal Side-Effects, BARS: the Barnes Akathisia Rating Scale, AIMS: Abnormal Involuntary...

Ngày tải lên: 08/08/2014, 21:20

5 367 0
Báo cáo y học: "Tissue engineering in the rheumatic diseases" ppsx

Báo cáo y học: "Tissue engineering in the rheumatic diseases" ppsx

... Wakitani S, Aoki H, Harada Y, Sonobe M, Morita Y, Mu Y, Tomita N, Nakamura Y, Takeda S, Watanabe TK, Tanigami A: Embryonic stem cells form articular cartilage, not teratomas, in osteo- chondral ... ethical concerns, easy data processability and reproducibility, and automatization and standardization [12]. The increasing prevalence of cartilage destruction in OA and RA has entailed...

Ngày tải lên: 09/08/2014, 01:22

11 397 0
w