Báo cáo y học: "Are chiropractors in the uk primary healthcare or primary contact practitioners?: a mixed methods study" docx
Báo cáo y học: "Are chiropractors in the uk primary healthcare or primary contact practitioners?: a mixed methods study" docx
... primary healthcare
or primary contact practitioners?: a mixed
methods study
Amanda R Jones-Harris
Abstract
Background: One of the debates regard ing the role of chiropractors is whether or not they ... chiropractors as
primary healthcare practitioners, each pertaining to a
different aspect of primary healthcare .Therespon-
dents were in agreement that when...
Báo cáo y học: "Inflammatory changes in the airways of mice caused by cigarette smoke exposure are only partially reversed after smoking cessation" docx
... emphysema, included
determination of the averag e inter-alveolar distance, was
estimated by the mean linear intercept (Lm) analysis.
The Lm was determined by light microscopy at a total
magnification ... to investigate the
effect of smoking cessation on airway remodeling and
pulmonary inflammation. The severity of airway remo-
deling and inflammation was studied by determining
alv...
Báo cáo y học: "Structural features in the Rous sarcoma virus RNA stability element are necessary for sensing the correct termination codon" potx
... CGAAACTAGTCCCTCNCTA-
TAAATTTGTC AAGCGG
PTC at 1250
AatII UAGN for CGCATGACGTCTAGNATCTAA
TGAGAG
EagI UAGG rev CGAACGGCCGCCCTCGCTAT
AAATTTGTCAAGCGG
Premature termination codons were introduced into ... GTGGCCCCTCCCT[TAGG]
GTAAACTTGTAGCGCTAACGC
QCPTC2631 CGCAATTAGTGGAAAAAGAATTA
[TAGG]
TAGGACATATAGAACCTTCACTTAGTTGTTGG
QCPTC2685 GAACACACCTGTCTTCGTG[TAGG]
GGAAGGCTTCCGGG
QCPTC2736 CATGATTTGCGCGCTGTT...
Báo cáo y học: " Processing sites in the human immunodeficiency virus type 1 (HIV-1) Gag-Pro-Pol precursor are cleaved by the viral protease at different rates" ppt
... pi120, appeared initially at the 2 minute
time point showing that RH /IN and RT/RH cleavage occur
relatively early in the processing cascade. The later and
BioMed Central
Page 1 of 6
(page number ... cleaved at rates that vary up to 400-
fold in vitro [9,13]. Initial cleavage occurs at the p2/NC
site followed by an intermediate rate of cleavage at the
MA/CA and p1/p6 sites, and...
Báo cáo y học: "Special considerations in the treatment of patients with bipolar disorder and medical co-morbidities"
... with
advanced cancer and pain. J Pain Symptom Manage 2002,
23:526-532.
83. Khojainova N, Santiago-Palma J, Kornick C, Breitbart W, Gonzales
GR: Olanzapine in the management of cancer pain. J Pain
Symptom ... anticoagulant and cardiovascular
medications. Olanzapine may induce or worsen cardiac
risk factors such as obesity, metabolic derangements and
hyperlipidemia. Quetiapine and risperi...
Báo cáo y học: "Genetic polymorphisms in the nucleotide excision repair pathway and lung cancer risk: A meta-analysis"
... that are capable of inducing muta-
tions and initiating carcinogenesis. The capacity to
repair DNA damage induced by activated carcinogens
appears to be one of the host factors that may influ-
ence ... may be
always a possible limitation of combining data from
various sources as in a meta-analysis. The idea of ad-
justing the results of meta-analyses for publication
bias an...
Báo cáo Y học: Expression pattern in the antennae of a newly isolated lepidopteran Gq protein a subunit cDNA potx
... After
its activation, different secondary pathways can occur:
adenylate cyclase catalyses the formation of cAMP,
whereas phospholipase C hydrolyses membrane phospha-
tidylinositol, liberating inositol ... 1,4,5-triphosphate (InsP
3
)
and diacylglycerol. Although cAMP and InsP
3
cascades
appear to be active as two alternative pathways in
vertebrate olfaction [7], mechanisms of olfactory si...
Báo cáo y học: "Treating rhinitis in the older population: special considerations" pdf
... rhinitis may be caused on rare occasions
by organisms such as Klebsiella ozaenae. Secondary
atrophic rhinitis may result from nasal surgery, particu-
larly from turbinectomy performed for nasal ... at
reconstituting support for the nasal upper lateral cartilage
and elevating the drooping nasal tip. Removal of tur-
binate mucosa should be avoided, especially when exces-
sive dryness is alr...
Báo cáo y học: "Physical anhedonia in the acute phase of schizophrenia" doc
... a "cardinal symptom"
preceding and possibly causing schizophrenia.
According to Chapman et al [7], there are two types of
anhedonia, physical anhedonia and social anhedonia.
Physical ... Physical Anhedonia Scale, PANSS: Positive and Negative
Syndrome Scale, EPSE: Rating Scale for Extrapyramidal Side-Effects,
BARS: the Barnes Akathisia Rating Scale, AIMS: Abnormal Involuntary...
Báo cáo y học: "Tissue engineering in the rheumatic diseases" ppsx
... Wakitani S, Aoki H, Harada Y, Sonobe M, Morita Y, Mu Y, Tomita
N, Nakamura Y, Takeda S, Watanabe TK, Tanigami A: Embryonic
stem cells form articular cartilage, not teratomas, in osteo-
chondral ... ethical concerns, easy data
processability and reproducibility, and automatization and
standardization [12].
The increasing prevalence of cartilage destruction in OA and
RA has entailed...