Báo cáo y học: "Introduction of a pyramid guiding process for general musculoskeletal physical rehabilitation" pot

... phases of inflammation con- trol and that, based on objective data, they are a good can- didate for non-surgical care, including physical rehabilitation. The proposed physical rehabilitation Pyramid Explanation ... tier may re-enforce this poor engram [9]. Additionally, tissues that are in an unwanted shortened state may affect the static and dynamic proprioception and engram of...

Ngày tải lên: 13/08/2014, 14:20

... SDS/PAGE. Autoradio- graphy was carried out on a BAS-IP NP 2040P imaging plate. Radioactivity was monitored with a Fujix BAS 2000 scanner (Raytest, Straubenhardt). Gel documentation was accomplished ... Germany; 2 Institute for Molecular Biosciences, The University of Queensland, St Lucia, Australia A novel photoactivatable analog of antisauvagine-30 (aSvg- 30), a specific antago...

Ngày tải lên: 31/03/2014, 08:20

... designed and validated several years ago. The new apparatus allows easier recording of animals by means of a battery of radar devices housed in specific ele- ments and arranged in a smaller space with ... chronobiology. Since this type of research generally requires a large amount of data from several weeks of monitoring, the use of automatic systems is necessary. Various...

Ngày tải lên: 10/08/2014, 09:20

... (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAA GA) and allele- specific primer s Pnf (AGCATTTGGTTTTAAATTATG- GAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA). The PCR was run for 35 cycles ... K, Kameda T, Takenaka K, Oku S, Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K, Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primary myelofibrosis a...

Ngày tải lên: 10/08/2014, 21:23

... presentation of information in a tabular, rather than descriptive form. Templates are created specif- ically for a particular setting and can be filled in by the reporting physician. Synoptic ... data collection and analysis. All authors read and approved the final manuscript. Additional material Acknowledgements This study has been funded by Cancer Services Innovation Partnership, a...

Ngày tải lên: 11/08/2014, 05:21

... locus Koichiro Yamada †1 , Tomonori Tsukahara †1 , Kazuhisa Yoshino †1 , Katsuhiko Kojima 1 , Hideyuki Agawa 1 , Yuki Yamashita 1 , Yuji Amano 1 , Mariko Hatta 1 , Yasunori Matsuzaki 1 , Naoki Kurotori 1 , ... not for citation purposes) 11. Tsukahara T, Agawa H, Matsumoto S, Matsuda M, Ueno S, Yamashita Y, Yamada K, Tanaka N, Kojima K, Takeshita T: Murine leukemia virus vector integratio...

Ngày tải lên: 12/08/2014, 23:22

... Masahiko Takahashi - masahiko@med.niigata-u.ac.jp; Masayasu Oie - moie@med.niigata-u.ac.jp; Yuetsu Tanaka - yuetsu@s4.dion.ne.jp; Yutaka Aoyagi - aoy@med.niigata-u.ac.jp; Masahiro Fujii* - fujiimas@med.niigata-u.ac.jp * ... Tax2 Toshiyuki Shoji †1,2 , Masaya Higuchi †1 , Rie Kondo 1 , Masahiko Takahashi 1 , Masayasu Oie 1 , Yuetsu Tanaka 3 , Yutaka Aoyagi 2 and Masahiro Fujii* 1 Address:...

Ngày tải lên: 12/08/2014, 23:22

... replicates and calculated the mean of these values. The ratio of this mean on the average of the intensity across the array set was then obtained. A ratio greater than 2 indicates that there was hybridization ... hope was that by demonstrating the feasibility and applicability for a single microarray representing diverse, pathogeni- cally important viruses, we would set the stage...

Ngày tải lên: 13/08/2014, 13:20

... compared to microarray genotype calls Accuracy of the variant calls in the NGS and ABI Sanger data for the four samples was initially assessed by comparison to genotype calls for approximately ... the variant quality analy- sis so as to focus on errors caused by the NGS platforms and thereby not have the analysis confounded by sample prepara- tion issues. Accuracy of sequence variant...

Ngày tải lên: 14/08/2014, 21:20

... Australian and New Zealand Intensive Care Society Adult Patient Database; APD = Adult Patient Database; ARCCCR = Australian and New Zealand Intensive Care Society Research Centre for Critical Care ... incidence of in-hospital CAs in a number of single-centre before-and-after studies [5-9]. A ANZ = Australia and New Zealand; ANZICS = Australian and New Zealand Intensive Care Societ...

Ngày tải lên: 25/10/2012, 10:35