Báo cáo y học: "Introduction of a pyramid guiding process for general musculoskeletal physical rehabilitation" pot
Báo cáo y học: "Introduction of a pyramid guiding process for general musculoskeletal physical rehabilitation" pot
... phases of inflammation con-
trol and that, based on objective data, they are a good can-
didate for non-surgical care, including physical
rehabilitation.
The proposed physical rehabilitation Pyramid
Explanation ... tier
may re-enforce this poor engram [9]. Additionally, tissues
that are in an unwanted shortened state may affect the
static and dynamic proprioception and engram of...
Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx
... SDS/PAGE. Autoradio-
graphy was carried out on a BAS-IP NP 2040P imaging
plate. Radioactivity was monitored with a Fujix BAS 2000
scanner (Raytest, Straubenhardt). Gel documentation was
accomplished ... Germany;
2
Institute for Molecular Biosciences, The University of Queensland, St Lucia,
Australia
A novel photoactivatable analog of antisauvagine-30 (aSvg-
30), a specific antago...
Báo cáo y học: "Validation of a microwave radar system for the monitoring of locomotor activity in mic pptx
... designed and validated several years ago.
The new apparatus allows easier recording of animals by
means of a battery of radar devices housed in specific ele-
ments and arranged in a smaller space with ... chronobiology. Since this type of
research generally requires a large amount of data from
several weeks of monitoring, the use of automatic systems
is necessary.
Various...
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx
... (CCTCAGAACGTTGATGGCA)
and P2r (ATTGCTTTCCTTTTTCACAA GA) and allele-
specific primer s Pnf (AGCATTTGGTTTTAAATTATG-
GAGTATATG) and Pmr (GTTTTACTTACTCTCGT
CTCCACAAAA). The PCR was run for 35 cycles ... K, Kameda T, Takenaka K, Oku S,
Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K,
Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primary
myelofibrosis a...
Báo cáo y học: "Development of a synoptic MRI report for primary rectal cancer" ppsx
... presentation of information in a tabular,
rather than descriptive form. Templates are created specif-
ically for a particular setting and can be filled in by the
reporting physician. Synoptic ... data collection
and analysis. All authors read and approved the final
manuscript.
Additional material
Acknowledgements
This study has been funded by Cancer Services Innovation Partnership, a...
Báo cáo y học: " Identification of a high incidence region for retroviral vector integration near exon 1 of the LMO2 locus" pot
... locus
Koichiro Yamada
†1
, Tomonori Tsukahara
†1
, Kazuhisa Yoshino
†1
,
Katsuhiko Kojima
1
, Hideyuki Agawa
1
, Yuki Yamashita
1
, Yuji Amano
1
,
Mariko Hatta
1
, Yasunori Matsuzaki
1
, Naoki Kurotori
1
, ... not for citation purposes)
11. Tsukahara T, Agawa H, Matsumoto S, Matsuda M, Ueno S, Yamashita
Y, Yamada K, Tanaka N, Kojima K, Takeshita T: Murine leukemia
virus vector integratio...
Báo cáo y học: " Identification of a novel motif responsible for the distinctive transforming activity of human T-cell leukemia virus (HTLV) type 1 Tax1 protein from HTLV-2 Tax2" pps
...
Masahiko Takahashi - masahiko@med.niigata-u.ac.jp; Masayasu Oie - moie@med.niigata-u.ac.jp; Yuetsu Tanaka - yuetsu@s4.dion.ne.jp;
Yutaka Aoyagi - aoy@med.niigata-u.ac.jp; Masahiro Fujii* - fujiimas@med.niigata-u.ac.jp
* ... Tax2
Toshiyuki Shoji
†1,2
, Masaya Higuchi
†1
, Rie Kondo
1
, Masahiko Takahashi
1
,
Masayasu Oie
1
, Yuetsu Tanaka
3
, Yutaka Aoyagi
2
and Masahiro Fujii*
1
Address:...
Báo cáo y học: "Use of a multi-virus array for the study of human viral and retroviral pathogens: gene expression studies and ChIP-chip analysis" pot
... replicates
and calculated the mean of these values. The ratio of this
mean on the average of the intensity across the array set
was then obtained. A ratio greater than 2 indicates that
there was hybridization ... hope
was that by demonstrating the feasibility and applicability
for a single microarray representing diverse, pathogeni-
cally important viruses, we would set the stage...
Báo cáo y học: " Evaluation of next generation sequencing platforms for population targeted sequencing studies" pot
... compared to
microarray genotype calls
Accuracy of the variant calls in the NGS and ABI Sanger data
for the four samples was initially assessed by comparison to
genotype calls for approximately ... the variant quality analy-
sis so as to focus on errors caused by the NGS platforms and
thereby not have the analysis confounded by sample prepara-
tion issues.
Accuracy of sequence variant...
Báo cáo y học: " Introduction of Medical Emergency Teams in Australia and New Zealand: a multi-centre study"
... Australian and New Zealand
Intensive Care Society Adult Patient Database; APD = Adult Patient Database; ARCCCR = Australian and New Zealand Intensive Care Society
Research Centre for Critical Care ... incidence of in-hospital CAs in a
number of single-centre before-and-after studies [5-9]. A
ANZ = Australia and New Zealand; ANZICS = Australian and New Zealand Intensive Care Societ...