Báo cáo y học: " Reflex control of the spine and posture: a

Báo cáo y học: " Reflex control of the spine and posture: a review of the literature from a chiropractic perspective" potx

... cervical spine: review of recent observations. Man Ther 2004, 9:71-76. 96. Yamada H, Honda T, Yaginuma H, Kikuchi S, Sugiura Y: Comparison of sensory and sympathetic innervation of the dura mater and ... function(s). A theoretical example may be a thoracolumbar pain caused by a swayback posture. It is postulated that the swayback posture may be the result of a fo...

Ngày tải lên : 13/08/2014, 13:22

17
518
0

Báo cáo y học: " b-Lapachone induces heart morphogenetic and functional defects by promoting the death of erythrocytes and the endocardium in zebrafish embryo" docx

... analyzed as described [32]. The primer pair for nppa was F-GGCAACAGAA- GAGGCATCAGAG and R-GGAGCTGCTGCTTC CTCTCGGTC. The primer pair for b-actin was F- CCATTGGCAATGAGAGGTTCAG and R-T GAT GGAGTTGAAAGTGGTCTCG. Results Phenotypes ... interpretation of data and helped to draft the manuscript. SPLH participated in the design of this study, performed statistical analysis, interpret...

Ngày tải lên : 10/08/2014, 10:20

13
371
0

Báo cáo y học: "Cholestatic jaundice, acute kidney injury and acute pancreatitis secondary to the recreational use of methandrostenolone: a case report" potx

... s acu te kidney injury and pancreatitis. Conclusion AAS use and misuse is being seen in an expanding population of patients because they are readily available and often perce ived as safe. The ... internet and at public gyms, they are easily obtained illegally, without a prescri ption. As a result, patients are less likely to report taking AAS to their physician and physicia...

Ngày tải lên : 11/08/2014, 00:23

5
274
0

Báo cáo y học: " Returning home: forced conscription, reintegration, and mental health status of former abductees of the Lord''''s Resistance Army in northern Uganda" pps

... contributions PNP and PV designed the study, conducted the field study in Uganda, and analyzed the data. PNP, PV, and ES inter- preted the data and wrote the report. All authors read and approved the final manuscript. Acknowledgements The ... captivity for less than one day were released by the LRA. The LRA may have abducted as many people as they could during a...

Ngày tải lên : 11/08/2014, 17:20

14
235
0

Báo cáo y học: "Suberoylanilide hydroxamic acid induces apoptosis and sub-G1 arrest of 320 HSR colon cancer cells" pot

... of the study and performed the analysis. JSJ conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final ... Bali P, Pranpat M, Swaby R, Fiskus W, Yamaguchi H, Balasis M, Rocha K, Wang HG, Richon V, Bhalla K: Activity of suberoylanilide hydroxamic acid against human breast cancer...

Ngày tải lên : 10/08/2014, 05:21

9
370
0

Báo cáo y học: "Glutathione-S-transferases in lung and sputum specimens, effects of smoking and COPD severity" ppsx

... previous page) GST alpha expression in the airways and in total lung homogenates. A. The GST alpha immunoreactivity in airway epithelium of central and peripheral airways. The staining was graded as ... material, analyzing the Western analysis results and performed part of the statistical analysis and participated in creating the figures. HM carried out the Weste...

Ngày tải lên : 12/08/2014, 14:20

10
210
0

Báo cáo y học: " Reducing ventilator-induced lung injury and other organ injury by the prone position" ppt

... inflammatory changes in pulmonary tissue [4]. As a result, subsequent pathophysiological pathways contribute to clinical symptoms and morbidity, including translocation of inflammatory mediators, ... colleagues [8] examined the overall parenchymal lung stress and strain, estimated from the transpulmonary plateau pressure and the tidal volume to end- expiratory lung volume ra...

Ngày tải lên : 12/08/2014, 23:23

2
204
0

Báo cáo y học: "Combining multicriteria decision analysis, ethics and health technology assessment: applying the EVIDEM decisionmaking framework to growth hormone for Turner syndrome patients" ppt

... conceived the framework. MW and HK participated in data collection and drafting of the manuscript. JPG and CD reviewed and validated synthesized data. All authors read and approved the final manuscript. Competing ... research grant from Pfizer Canada. Author details 1 BioMedCom Consultants inc, Dorval, Quebec, Canada. 2 Population Health Research Unit of the CHA, and...

Ngày tải lên : 13/08/2014, 11:22

15
326
0

Báo cáo y học: " Size control in growing yeast and mammalian cells" docx

... shorter than in mammalian cells. It is also true, as Conlon and Raff [1] point out, that the pattern of total protein and RNA content in several yeast cdc mutants was approxi- mately exponential over a ... is grateful to the Hungarian Academy of Sciences for a Janos Bolyai Research Fellowship. References 1. Conlon I, Raff M: Differences in the way a mammalian cell and...

Ngày tải lên : 13/08/2014, 22:22

3
216
0

Báo cáo y học: "Gender differences in suicidal expressions and their determinants among young people in Cambodia, a post-conflict country" doc

... took part in the design of the study, carried out the data-collection and analysis, and drafted the manuscript. GK participated in the design of the study, performed the statistical analysis, ... 15. The lit- eracy rate is 85% for males and 64% for females. Eighty percent of the population of 14.5 million is rural and one sixth of the country’ s land is c...

Ngày tải lên : 11/08/2014, 15:22

8
411
0