Báo cáo y học: "Anatomic and functional leg-length inequality: A review and recommendation for clinical decision-making Part I, anatomic leg-length inequality: prevalence, magnitude, effects and clinical significance" pdf
Báo cáo y học: " Axillary silicone lymphadenopathy presenting with a lump and altered sensation in the breast: a case report" pot
... Tabatowski K, Elson CE, Johnston WW: Silicone lymphadeno- pathy in a patient with mammary prosthesis. Fine needle aspiration cytology, histology and analytical electron micro- scopy. Acta Cytol ... Cases Database Any patient, any case, can teach us something www.casesnetwork.com Abbreviations ARDS, adult respiratory distress syndrome; FNA, fine needle aspiration; FNAC, fine needle aspirat...
Ngày tải lên: 11/08/2014, 17:21
Báo cáo y học: " Andrew Kaplan (1959–2006): remembering a friend and a colleague" ppsx
... peer review as a reviewer for the Journal of Virology, always grateful for his thoughtful reviews. Over the last year he was one of the most active reviewers for JV. Andy was one of a very small ... fundamental questions about the viral protease. In the last few years Andy's intellectual breadth became fully apparent as did his role as a mentor and collabora- tor. He made...
Ngày tải lên: 13/08/2014, 09:20
Báo cáo y học: " “The non-ischemic repair” as a safe alternative method for repair of anterior post-infarction VSD" pptx
... perform the necessary distal coronary anastomoses and subsequently the proximal by partial clamping of the aorta (for the cases with more than one graft). After completion of the proximal anastomoses the ... Determinants and prognosis of myocardial damage after coronary artery bypass grafting. Ann Thorac Surg 2005, 79:837-45. 9. Weisel R: Myocardial protection during for mechanical com...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: "Measles vaccination in humanitarian emergencies: a review of recent practice" potx
... Both appeals are coordinated by OCHA (United NationsOfficefortheCoordination of Humanitarian Affairs) with parti cipation from NGOs and UN agenci es. Although the CAP/Flash appeal may not have ... vitamin A deficiency. Many deaths attributed to diarrheal dis ease and pneumo- nia may also be associated with measles. In the past, measles case-fatality ratios i n children in humanitarian e...
Ngày tải lên: 13/08/2014, 15:21
Báo cáo Y học: Azidothymidine causes functional and structural destruction of mitochondria, glutathione deficiency and HIV-1 promoter sensitization pptx
... separated from nonacetylated chloramphenicol by ascending thin-layer chromatography [18]. Chromatograms were examined and quantified with a Fuji image analyzer BA100. HIV-1-LTR DNA binding assay HIV-1-LTR ... & Ames, B.N. (1987) Normal oxidative damage to mitochondrial and nuclear DNA is extensive. Proc. Natl Acad. Sci. USA 85, 6465–6467. 25. Hayakawa, M., Ogawa, T., Sugiyama, S., Ta...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo y học: "Association of functional variants of PTPN22 and tp53 in psoriatic arthritis: a case-control study" docx
... study was 39.6 years (standard deviation 11.3 years). The mean age at onset of psoriasis was 26.8 years (standard deviation 12.1 years) and the mean age at onset of PsA was 33.0 years (standard ... Newfoundland PsA patients, 53% were male and their mean age at onset of the study was 49.7 years. The mean age at onset of psoriasis was 29.3 years (standard deviation 14.2 years) and the mea...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "valuation of endoscopic vein extraction on structural and functional viability of saphenous vein endothelium" potx
... has concluded that EVH was associated with lower SV graft patency at 1-year and higher rate of perioperative myocar- dial infarction and need for revascularization within 1-year compared to OSVH [27]. Although ... Boston, MA. Tran- sit time and temperature (20 ± 2.2 hours; 7 ± 2.3°C; respectively) were recorded in the laboratory. Structural and Functional Assays Cell Viability Ass...
Ngày tải lên: 10/08/2014, 09:21
Báo cáo y học: "Cleavage of functional IL-2 receptor alpha chain (CD25) from murine corneal and conjunctival epithelia by MMP-9" pptx
... measured by an immunobead assay. Results: CD25 and CD122 were abundantly expressed in cornea (all layers) and conjunctiva epithelia (apical and subapical layers) in nonstressed control mice. After ... life and death of lymphocytes: implications for immunotherapy. Immunity 2001, 14:105-110. 3. Miyazaki T, Liu ZJ, Kawahara A, Minami Y, Yamada K, Tsujimoto Y, Barsoumian EL, Permutt...
Ngày tải lên: 11/08/2014, 08:22
Báo cáo y học: "Identification of an effective siRNA target site and functional regulatory elements, within the hepatitis B virus posttranscriptional regulatory element" ppt
... 5′- agcttttccaaaaaaagctcatcggaactgacaatctcttgaattgtcagttcc- gatgagctg-3′; PRE 1329 5′-gatccgctgacaattctgtcgtcctttcaa- gagaaggacgacagaattgtcagttttttggaaa-3′ ; AtPRE1329 5′- agcttttccaaaaaactgacaattctgtcgtccttctcttgaaaggacgaca- gaattgtcagcg-3′. ... and various amount of pSiRNA expression plasmids as indicated, pUC18 was used to make up the total DNA to 1 μg. Cells were harvested at day 1, day...
Ngày tải lên: 12/08/2014, 01:21
Báo cáo y học: " Conservation of functional domains and limited heterogeneity of HIV-1 reverse transcriptase gene following vertical transmission" pdf
... GTACAG- TATTAGTAGGACCTACACCTGTC, 2470 to 2498, sense) and RT2 (5'AAAATCACTAGCCATTGCTCTCCAATTAC, 4307 to 4279, antisense) and then with nested primers RT3 (5'TGGAAGAAATCTGTTGACTCAGATTGG, ... acts as an RNA-dependant DNA polymerase, a DNA-dependant DNA polymerase and has RNase H activity associated with the C-terminus [15,16], whereas the p51 subunit lacks the C-terminus RNase...
Ngày tải lên: 13/08/2014, 09:21