0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "Psychosocial factors and their role in chronic pain: A brief review of development and current stat" ppsx

Báo cáo y học:

Báo cáo y học: "Psychosocial factors and their role in chronic pain: A brief review of development and current stat" ppsx

... factors and their role in chronic pain: A brief review of development and current statusStanley I Innes*Address: Private Practice 35 Maroondah Highway, Lilydale, 3140, AustraliaEmail: Stanley ... Cognitive Behavioural models dominate the research landscape in this area.They are gaining wider acceptance and some aspects are being integrated and implemented into a number of health care systems. ... H, Spear FG: Pain: Psychological and psychiatric aspects Bailliere,Tindall and Cassell: London; 1967. 2. Bonica JJ: Pain research and therapy, achievements of the past and challenges of the...
  • 5
  • 355
  • 0
Báo cáo y học:

Báo cáo y học: "Learning lessons from field surveys in humanitarian contexts: a case study of field surveys conducted in North Kivu, DRC 2006-2008" pot

... accuracy of the data analysis. All authors partici-pated in the conception and design of the study; analysis and interpretation of data; drafting the paper and revisingit critically for substantial ... and facilitate critical appraisal and interpretation. The Stand-ardized Monitoring and Assessment of Relief and Transi-tions (SMART) initiative aims to ensure standardization of planning, training, ... an abnormal increase in the number of cases of malaria, diarrhea and measlesؠ Community awareness campaign about the NGOs activitiesConflict and Health 2009, 3:8 http://www.conflictandhealth.com/content/3/1/8Page...
  • 8
  • 326
  • 0
Báo cáo y học:

Báo cáo y học: "Migration events play significant role in genetic differentiation: A microsatellite-based study on Sikkim settlers" ppt

... Onthebasis of microsatelliteanalysisitmaybeconcludedthatthepresentgeneticstructure of mongoloids of Sikkimisnotakintothemongoloids of NortheastIndia in spite of their similarethnicity, and similarhabitate.Duetolongtimeisolation and amalgamationwithnon-mongoloids of adjacentareathesecommunitiesexhibit a mixedgenepool.Thetime of divergencerevealtheroute of thepossiblemigration of Lepcha of Sikkim in IndiawasfromEastAsiathroughTibet.Thiscouldbethereason of their highgeneticaffinitywithNepali,Bhutia, and thosepopulations(e.g.Chinese)whohadalsomigratedviathesameroutei.e.Zang(Tibet)-maincorridor,themostfrequentroutetoentertheHimalayasfromtheeast(Fig.2).Theextent of geneticvariation in threepredominantmongoloidpopulations of Sikkim and mongoloids of northeastIndiacouldbeattributedtosignificant role playedbymigratoryevents in geneticdifferentiation.Although a largernumber of lociareessentialfordrawingAbstractBackground: A widespectrum of geneticdiversity in mongoloids of Indiaiswelldocumented.Thoughallmongoloids of IndiaareknowntohaveoriginatedfromtheMongolregion of Chinabuttheperiod and route of migrationfrom their nativelandtodifferentHimalayanregionsislittleknown.Thusthestudiesongenomicdiversity of people of Sikkim, a centralHimalayanstate of Indiawithdifferentmigrantmongoloidgroups,assumegreatsignificance in understandingtheimpact of migratoryevents in thegeneticdifferentiation of populations.Wethereforestudiedthegeneticdiversityonthebasis of 13-tetranucleotide and 2pentanucleotidemicrosatellitelocifor a total of 208allelefrequencies in threemajorpopulations of Sikkim,withdifferentethnohistory and time of settlement.Result:Thestudyonmicrosatelliteallelefrequencydatasuggeststhatallthethreepopulations of Sikkimaregeneticallymoreakintothemongoloids of China and distinctlyapartfromthemongoloids of NortheastIndia.HoweverSikkimpopulationsarealsogeneticallyclosetonon-mongoloids of surroundingareas.Theaverageheterozygosity and coefficient of genedifferentiationamongSikkimpopulationsaremoderate.Number of sharedalleles and their frequencies,time of divergence and bottleneckeffectreveal a distinctiveness of themongoloidssettled in SikkimfromthemainIndianmongoloidstockasalsodifferentroute of migrationthanthemongoloidpopulation of NortheastIndia.Conclusion:Ourstudyclearlydemonstratesthatthepresentdaymongoloids of Sikkimaregeneticallydistinctfrommongoloids of NortheastIndiadueto their differentroute of migration,time of settlement, and admixturewithothernon-mongoloidpopulations of adjoiningareas.Thissubstantiatesthatmigratoryeventshaveplayed a significant role in thedifferentiation of mongoloids of India.whichbelongtoTibeto-Burmanlinguisticsubfamily and representtheIndo-Mongoloidethnicgroup of NortheastIndia[34].Brahmins of Orissa(n=60)[39],Bihar(n=59)[40] and Karnataka(n=65)[41]havebeentakentobe of theIndo-Caucasianorigin.Chinese and Caucasiandatahavebeenusedforglobalpopulationreference[42].StatisticalAnalysis:-Thefrequencies of eachalleleforindividualSTRlociwerecalculatedfromthenumber of eachgenotype in thesamplesetbythemethod of genecount[43].Wehaveused165alleles of 12microsatellitelociforcomparison,sincedataonD16S539,PentaE, and PentaDlociarenotavailableforNortheastIndianpopulations.Thenumber of sharedalleles and their variance(V)werescoredforthe12loci in MICROSATtochecktheallelicdiversityamongthepopulations.Pair-wisegeneticdistancesamongpopulationswerecomputedusingvariousdistancemeasuresD A [44],Ds[14],Dc[45],Dsw[46],(δµ)2[17] and Fst[47]with1000replicationsusingsimulationprogramMICROSAT[48].Thesegeneticdistancemeasuresareseentobe a highlyefficientparameterforcomputingcorrectphylogenytrees and evolutionarytimespanunderdifferentevolutionaryconditions.Besidestheyareleastaffectedbysmallsamplesize[27].Phylogenyanalysiswascarriedoutfollowingtheneighbourjoining(NJ)[49] and theunweightedpairgroupmethodwitharithmeticmean(UPGMA)[50]methods.TheGst(genediversity) and heterozygosityvalueswerecomputedusingtheprogrammeDISPAN[51] and programme[52]wasusedforgeneratingphylogenetictrees.Time of separationfromcommonancestorhasbeencalculatedbyusingthegeneticdistancesDs,Dsw and (δµ)2betweenpopulations.SIGNtestfor15microsatelliteloci of Sikkimpopulationswasperformedtocheckwhetherpopulationsexperiencedanybottleneck in recentpastornot[26]underIAM(Infiniteallelemodel)aswellasSMM34.SinghKS:India'sCommunities,NationalSeries.People of India.OxfordUniversityPress,1998.35.Kashyap ... Theaboveadvantageshavemademicrosatellitemarkersextremelyinformative in understandingthegeneticstructure,migratoryhistory and evolution of humanpopulations[21-23] and ourmarker of choicetoexaminetheimpact of migratoryeventsonthegeneticdifferentiation of Sikkimsettlers and their geneticrelationshipwithothermongoloids of NortheastIndia, and Caucasoid-affiliatedpopulations of adjoiningarea.ResultsGeneticdifferentiation&heterozygosity:-Locus and populationwiseheterozygosity and Gst(coefficient of genedifferentiation)valuesreflectingtheextent of differentiationamongthepopulations of Sikkimareshown in Table1.TheaverageGstvalue(0.0237)suggestsmoderatedegree of genedifferentiationamongthestudiedpopulations.Thevalueshowevervastlydifferfromlocitoloci;itisonly0.004atlociD3S1358, and D16S539,while0.088atlociFGA.Similarlymoderatedifferentiation(0.0206to0.0365)wasobservedatlociPentaD,CSF1PO,TPOX,D8S1179,VWA,D5S818 and D7S820.Averageheterozygosityobservedatdifferentlocidepictsthemongoloidethnicgroup,albeittheLepchaaresaidtobetheforerunneramongthesettlers in thestate,followedbyBhutia and Nepalimigration in thestate[1].TheBhutiacommunityisbasicallythepeople of Tibetan(Chinese)origin, and their migrationtoSikkimhadoccurredatleast800yearsago.TheNepalesearrived in Sikkimabout200yearsago[1].Thoughthemigration of LepchatoSikkimis a contentiousissue,therearetwomajortheoriesabouttheLepchaorigin and period of migrationtoSikkim:(i) A smallpopulation of NagastockfromtheGarohills of AssammigratedtoSikkimabout2000yearsago, and (ii) a groupfromeastAsiamainlandmigratedthroughTibet(China)duringanearlierphase of humanmigrationtotheHimalayasatleast3000yearsago[1].Thecomplexmigration and settlementhistory of differentgroups in Sikkimwithrespectto their genetichistoryisstilllittleknown.Autosomal and Y chromosomeSTRmarkers[2-4],aswellasMitochondrialDNA[5]studiesillustratemigration and geneticdiversity of mongoloids in East and South-EastAsia.Thesestudies,however,donotprovideanyinformationaboutmongoloidmigration and settlement in differentregions of India.Although,severalstudieshavebeencarriedoutongeneticdiversity,phylogeneticrelationship, and thepattern of geneflowamongIndianmongoloidpopulationsbasedonclassicalgeneticmarkers,e.g.Tf,Ge,PGM1loci[6,7],serumproteins and redcellenzymes[8], and a combinedstudybyRoychoudhury and Nei.[9],theyfailtoprovideanyinsightintothehistory of migration and settlement of Mongoloids in India.Similarlythestudywith17polymorphicsystem of thebloodbyBhasinetal.1986providesinformationaboutthegeneticstructure of people of Sikkimtosomeextent. In thisstudyweusedmicrosatelliteDNAmarkerstoaddresstheconsequence of migratoryeventsongeneticstructure of Sikkimpopulationsas,theyaremoreabundant in the44.Nei ... SahaN,BhattacaryyaSP,MukhopadhyayB,BhattacharyyaSK,GuptaR,Basu A: A geneticstudyamongtheLepchas of theDarjeelingarea of easternIndia,HumanHeredity198 7a, 37:113-121.7. SahaN,MukhopadhyayB,BhattacharyyaSK,GuptaR,Basu A: Thedistribution of transferring, group-specific...
  • 27
  • 625
  • 0
báo cáo khoa học:

báo cáo khoa học: "Organizational interventions to implement improvements in patient care: a structured review of reviews" pptx

... needed. Many patientoutcomes are not only influenced by the performance of individual care providers, but also by the functioning of clinical teams and by broader organizational and finan-cial structures. ... Change of tasks and responsibilities of health professionals, such as increased medical roles to nurses and enlarging the roles of pharmacists.- Multidisciplinary teams: Clinical teams or collaborations ... professional roles, multi-disciplinary teams, use of computers systems, and components of quality management. Continued educa-tion of health professionals and patient education areusually components of...
  • 9
  • 293
  • 0
Báo cáo y học:

Báo cáo y học: "Psychosocial factors and their predictive value in chiropractic patients with low back pain: a prospective inception cohort study" docx

... progresstowards chronic pain and disability [12].Acute pain gives rise to anxiety about its aetiology and prognosis [11], whereas chronic pain is distressing and may reinforce fears that the cause ... 200 patients initially approached to participate in the study, 158 were eligible to participate and completedthe baseline questionnaires. (Ineligibility was mainly byreason of having pain below ... presence of adverse psycholog-ical factors, such as anxiety, fear or distress/depression,may have the effect of intensifying the perceived severity of pain and may play an important role in progresstowards...
  • 7
  • 286
  • 0
Báo cáo y học:

Báo cáo y học: "Hereditary angioedema: beyond international consensus - circa December 2010 - The Canadian Society of Allergy and Clinical Immunology Dr. David McCourtie Lecture" pps

... with large phase IV clinical trials, meta analyses,data base registry validation of ap proaches including quality of life and cost benefit analyses, safety, and head-to-head clinical trials investigating ... syndromes, nausea, vomiting,diarrhea, and life-threatening airway swellings.Untreated airway angioe dema has an associated signifi-cant risk of dying from asphyxia. The first angioedemamay ... to teaching in thefield of Allergy and Clinical Immunology and was well respected as a physician, teacher and colleague. The 2010 Canadian Society of Allergy and Clinical Immunology Dr. David...
  • 14
  • 698
  • 0
Báo cáo y học:

Báo cáo y học: "Differential responsiveness to immunoablative therapy in refractory rheumatoid arthritis is associated with level and avidity of anti-cyclic citrullinated protein autoantibodies: a case study" pps

... reactivation of humoral autoimmunity after immunoablative therapy, we ana-lyzed the avidity of reappearing ACPA-IgG autoantibodies bydichotomizing patients according to their pre-transplantationACPA-IgG ... immunoablative therapy of ACPA-IgG autoantibodies with low avidityRegeneration after immunoablative therapy of ACPA-IgG autoantibodies with low avidity. (a) Low avidity of antibodies against anti-cyclic citrullinated ... of high avidity ACPA-IgG. The distinctclinical disease course after immunoablative therapy based onlevels and avidity of ACPA-IgG indicates that refractory RA isnot a single disease entity.IntroductionRheumatoid...
  • 9
  • 426
  • 0
Báo cáo y học:

Báo cáo y học: "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" ppt

... 13AD3.1ND.1AD8.2AD3.2ND.2AD8.1counts / millionATCTGAGTTGGGAGGGTCCCTCTCCAAA TGTGTCTTGGGGTGGGGGATCAAGACACATTTGGAGAGGGAACCTCCCAACTCGGCCTCTGCCATCAT TAGACACATTTGGAGAGGGAACGTCCCTCTCCAAATGTGTCT TG070140210280hsa−mir−64 2a ... combiningseveral levels of regulation. Signaling pathways, such ascAMP and insulin signaling pathways, as well as key tran-scription factors, such as PPARg,C/EBPb and Krüppel-like transcription factors ... inhibition of themiR-30 family, RNA was extracted and analyzed at day 10 of differentiation. (b) For over-expression of pre-miR3 0a and pre-miR-30d,RNA was extracted and analyzed at day 4 of differentiation....
  • 13
  • 365
  • 0
Báo cáo y học:

Báo cáo y học: " Human Immunodeficiency Virus Type 1 Nef protein modulates the lipid composition of virions and host cell membrane microdomains" pot

... the past years, the application of new dyessuch as Laurdan and the real-time visualization of proteindynamics during signalling processes have largely corrob-orated the membrane microdomain ... manipulates a variety of transport and signal transduction processes in cells infected by HIV-1. Modulation of cellular transport paths by Nef affectsthe surface presentation of an increasing ... total amount of protein was held constant. ethanol/cholesterol/cyclo-dextrine was added in increasing amounts up to a molarratio of protein to ligand of 1 to 2.Competing interestsThe author(s)...
  • 12
  • 384
  • 0
Báo cáo y học:

Báo cáo y học: "Recently published papers: Novel therapies in chronic obstructive pulmonary disease, cardiac chemicals and intensive care outcomes" ppt

... received an average of 1,034 kcal/day and 47 g protein/day. An increase of 1,000 cal/day was associated with reduced mortality. Theeffect of increased calories associated with lower mortalitywas ... the increasedrisk of haemorrahge and need for monitoring has sparkedmuch research, and a recent study tested a new directthrombin inhibitor, dabigatran, against warfarin [9]. Connolly and ... Jeejeebhoy K, Day AG, DhaliwalR, Heyland DK: The relationship between nutritional intake and clinical outcomes in critically ill patients: results of aninternational multicenter observational study....
  • 3
  • 149
  • 0

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ