Báo cáo y học: "Psychosocial factors and their role in chronic pain: A brief review of development and current stat" ppsx
Báo cáo y học: "Psychosocial factors and their role in chronic pain: A brief review of development and current stat" ppsx
... factors and their role in chronic pain: A brief review of development and current status Stanley I Innes* Address: Private Practice 35 Maroondah Highway, Lilydale, 3140, Australia Email: Stanley ... Cognitive Behavioural models dominate the research landscape in this area. They are gaining wider acceptance and some aspects are being integrated and implemented...
Ngày tải lên: 13/08/2014, 13:22
Báo cáo y học: "Learning lessons from field surveys in humanitarian contexts: a case study of field surveys conducted in North Kivu, DRC 2006-2008" pot
... accuracy of the data analysis. All authors partici- pated in the conception and design of the study; analysis and interpretation of data; drafting the paper and revising it critically for substantial ... and facilitate critical appraisal and interpretation. The Stand- ardized Monitoring and Assessment of Relief and Transi- tions (SMART) initiative aims to ensure standa...
Ngày tải lên: 13/08/2014, 13:21
Báo cáo y học: "Migration events play significant role in genetic differentiation: A microsatellite-based study on Sikkim settlers" ppt
... Onthebasis of microsatelliteanalysisitmaybeconcludedthatthepresentgenetic structure of mongoloids of Sikkimisnotakintothemongoloids of NortheastIndia in spite of their similarethnicity, and similarhabitate.Duetolongtimeisolation and amalgamation withnon-mongoloids of adjacentareathesecommunitiesexhibit a mixedgenepool.Thetime of divergencerevealthero...
Ngày tải lên: 14/08/2014, 14:21
báo cáo khoa học: "Organizational interventions to implement improvements in patient care: a structured review of reviews" pptx
... needed. Many patient outcomes are not only influenced by the performance of individual care providers, but also by the functioning of clinical teams and by broader organizational and finan- cial structures. ... Change of tasks and responsibilities of health professionals, such as increased medical roles to nurses and enlarging the roles of pharmacists. - Multidisciplinary t...
Ngày tải lên: 11/08/2014, 05:21
Báo cáo y học: "Psychosocial factors and their predictive value in chiropractic patients with low back pain: a prospective inception cohort study" docx
... progress towards chronic pain and disability [12]. Acute pain gives rise to anxiety about its aetiology and prognosis [11], whereas chronic pain is distressing and may reinforce fears that the cause ... 200 patients initially approached to participate in the study, 158 were eligible to participate and completed the baseline questionnaires. (Ineligibility was mainly by reason of...
Ngày tải lên: 13/08/2014, 14:20
Báo cáo y học: "Hereditary angioedema: beyond international consensus - circa December 2010 - The Canadian Society of Allergy and Clinical Immunology Dr. David McCourtie Lecture" pps
... with large phase IV clinical trials, meta analyses, data base registry validation of ap proaches including quality of life and cost benefit analyses, safety, and head-to- head clinical trials investigating ... syndromes, nausea, vomiting, diarrhea, and life-threatening airway swellings. Untreated airway angioe dema has an associated signifi- cant risk of dying from asphyxia. The f...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "Differential responsiveness to immunoablative therapy in refractory rheumatoid arthritis is associated with level and avidity of anti-cyclic citrullinated protein autoantibodies: a case study" pps
... reactivation of humoral autoimmunity after immunoablative therapy, we ana- lyzed the avidity of reappearing ACPA-IgG autoantibodies by dichotomizing patients according to their pre-transplantation ACPA-IgG ... immunoablative therapy of ACPA-IgG autoantibodies with low avidityRegeneration after immunoablative therapy of ACPA-IgG autoantibodies with low avidity. (a) Low avidity of a...
Ngày tải lên: 09/08/2014, 10:21
Báo cáo y học: "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" ppt
... 13 AD3.1 ND.1 AD8.2 AD3.2 ND.2 AD8.1 counts / million ATCTGAGTTGGGAGGGTCCCTCTCCAAA TGTGTCTTGGGGTGGGGGATCAAGACACATTTGGAGAGGGAACCTCCCAACTCGGCCTCTGCCATCAT TAGACACATTTGGAGAGGGAACGTCCCTCTCCAAATGTGTCT TG 0 70 140 210 280 hsa−mir−64 2a ... combining several levels of regulation. Signaling pathways, such as cAMP and insulin signaling pathways, as well as key tran- scription factors, such as PPA...
Ngày tải lên: 09/08/2014, 23:20
Báo cáo y học: " Human Immunodeficiency Virus Type 1 Nef protein modulates the lipid composition of virions and host cell membrane microdomains" pot
... the past years, the application of new dyes such as Laurdan and the real-time visualization of protein dynamics during signalling processes have largely corrob- orated the membrane microdomain ... manipulates a variety of transport and signal transduction processes in cells infected by HIV- 1. Modulation of cellular transport paths by Nef affects the surface presentation of...
Ngày tải lên: 13/08/2014, 05:22
Báo cáo y học: "Recently published papers: Novel therapies in chronic obstructive pulmonary disease, cardiac chemicals and intensive care outcomes" ppt
... received an average of 1,034 kcal/day and 47 g protein/day. An increase of 1,000 cal/day was associated with reduced mortality. The effect of increased calories associated with lower mortality was ... the increased risk of haemorrahge and need for monitoring has sparked much research, and a recent study tested a new direct thrombin inhibitor, dabigatran, against warfarin [9]...
Ngày tải lên: 13/08/2014, 19:20