Báo cáo y học: "Skin prick testing does not reflect the pres

Báo cáo y học: "Skin prick testing does not reflect the presence of IgE against food allergens in adult eosinophilic esophagitis patients: a case study." doc

... testing does not reflect the presence of IgE against food allergens in adult eosinophilic esophagitis patients: a case study Toral A Kamdar, Anne M Ditto, Paul J Bryce * Abstract Skin prick testing ... a minimum of one aero and one food allergen. None of the patients has a his- tory of IgE- mediated food allergy and, instead had bee...

Ngày tải lên : 13/08/2014, 13:22

3
295
0

Báo cáo y học: "Skin prick testing in patients using beta-blockers: a retrospective analysis" pot

... relatively contra- indicated during allergy skin testing. The American Academy of Allergy Asthma & Immunology (AAAAI) outlines t his in its position statement, stating that “Sys- temic reactions ... obstruc- tive pattern on their spirometry, as indicated by having a FEV1/FVC < 75% predicted. One patient was taking cetirizine and another was taking amitriptyline at the time...

Ngày tải lên : 08/08/2014, 21:20

4
392
0

Báo cáo y học: "Systemic TNF blockade does not modulate synovial expression of the pro-inflammatory mediator HMGB1 in rheumatoid arthritis patients – a prospective clinical study" ppt

... β-actin, forward CCTTCGTGCCCCCCC and reverse GGAGAC- CAAAAGCCTTCATACATC; and for HMGB1, forward ATTGGTGATGTTGCGAAGAA and reverse GATCCACAG- CAACTCCAGAA. The volume was adjusted to 15.5 μl using RNase-free ... staining was evident in all nine patients before and during infliximab treatment and was most prominent in the lining layer, in areas with cellular infiltrates and in certa...

Ngày tải lên : 09/08/2014, 10:23

8
529
0

Báo cáo y học: "Mannose-binding lectin does not explain the course and outcome of pregnancy in rheumatoid arthritis" pot

... and the accuracy of the data analysis. FG, MW, YM, AD, MH and RD designed the study. FG, MW and YM were involved in the acquisition of the data. FG, MW, SW, MH and RD analyzed the matrix-assisted ... on the basis of its binding to agalactosyl IgG, which can activate the complement system [3] and therefore lead to increased inflammation [1]. However, we hypothesize tha...

Ngày tải lên : 12/08/2014, 15:22

7
341
0

Báo cáo y học: "Collective consciousness and its pathologies: Understanding the failure of AIDS control and treatment in the United States" doc

... 10:711-717. ˆ Y ˆ y ˆ y ˆ y ˆ y ˆ y ˆ y ˆ y ˆ y fy y n dy y nn jj j n (,) (,).= () = ∑ 1 27 1 ˆ y ˆ y Dpydyy nnn y n = () ∑ ()(,). 28 ˆ Y ˆ Y ˆ Y ˆ Y ˆ Y ˆ Y ˆ y RD IYY pyy pypyydyy D yy () min (,). (,); ()(|)(,) (,) = ∑ () ≤ 29 ˆ y ˆ y ˆ y ˆ y ˆ y ˆ y ˆ Y ˆ Y ˆ Y Theoretical ... prized their ability to interpret their holy books. Wh...

Ngày tải lên : 13/08/2014, 16:21

36
376
0

báo cáo hóa học:" Serous papillary adenocarcinoma possibly related to the presence of primitive oocyte-like cells in the adult ovarian surface epithelium: a case report" docx

... revealed by DAPI staining (Figure 6C). This type of cells is usually not present in the healthy adult human ovarian surface epithelium. Discussion Serous adenocarcinoma is a type of epithelial ... ovarian or other cancers are at the highest risk of having ovarian serous carcinoma, especially if their mother or sister had ovarian cancer. Other risk factors include: increased...

Ngày tải lên : 20/06/2014, 08:20

5
406
0

Báo cáo y học: "T cell Activation does not drive CD4 decline in longitudinally followed HIV-infected Elite Controllers" docx

... University Health Centre, Montréal, Québec, Canada Full list of author information is available at the end of the article Kamya et al. AIDS Research and Therapy 2011, 8:20 http://www.aidsrestherapy.com/content/8/1/20 © ... assay (bDNA) (Bayer Diagnostics, Tarrytown, NY) with a detection limit of 50 HIV-1 RNA copies/ml of plasma. Cells Blood was obtained by either venipuncture in...

Ngày tải lên : 10/08/2014, 05:22

7
235
0

Báo cáo y học: " C-reactive protein does not opsonize early apoptotic human neutrophils, but binds only membrane-permeable late apoptotic cells and has no effect on their phagocytosis by macrophages" pot

... material means that they stain very faintly with May-Giemsa, and in the past late apoptotic cells may have been gated out as "debris" when analysed by flow cytometry. Furthermore, these cells ... whereas binding to polycations may be responsible for the heparin-inhibita- ble Ca 2+ -independent component [19]. The relative pau- city of nuclear chromatin in the late apop...

Ngày tải lên : 11/08/2014, 08:21

8
257
0

Báo cáo y học: "Urinary interleukin-18 does not predict acute kidney injury after adult cardiac surgery: a prospective observational cohort study" docx

... urinary IL-18 concentration and urinary IL-18/urinary creatinine ratio in relation to the postoperative development of acute kidney injury defined as an increase in serum creatinine of greater ... possible that urinary IL- 18 would be of greater value in patients at increased risk of developing AKI. In the absence of adjudication of aetiology, the sustained increase...

Ngày tải lên : 13/08/2014, 11:22

8
304
0

Báo cáo y học: "Respirator fit-testing - will we pass the test" docx

Ngày tải lên : 13/08/2014, 19:20

1
153
0

Báo cáo y học: "Skin prick testing does not reflect the presence of IgE against food allergens in adult eosinophilic esophagitis patients: a case study " doc

Báo cáo y học: "Skin prick testing does not reflect the presence of IgE against food allergens in adult eosinophilic esophagitis patients: a case study." doc

Báo cáo y học: "Skin prick testing in patients using beta-blockers: a retrospective analysis" pot