Báo cáo y học: "Asthma is a risk factor for acute chest syndrome and cerebral vascular accidents in children with sickle cell disease" ppt
Báo cáo y học: "Asthma is a risk factor for acute chest syndrome and cerebral vascular accidents in children with sickle cell disease" ppt
... Central Page 1 of 5 (page number not for citation purposes) Clinical and Molecular Allergy Open Access Research Asthma is a risk factor for acute chest syndrome and cerebral vascular accidents in ... that recent and recurrent episodes of acute chest syndrome are risk factors for cerebral vascular accidents [10]. Our findings of increased cerebr...
Ngày tải lên: 13/08/2014, 13:22
Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx
... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... features include dextrocardia, L-transposition of the great arteries, abdominal situs inversus, bilateral (a) t TCTCCCTCCA...
Ngày tải lên: 09/08/2014, 23:20
Báo cáo y học: "What is a virulence factor" pot
... Seguin M, Yuan L, Kelly N, Hammack C, Sadoff J, Gemski P Jr.: The importance of a lipopolysaccharide-initi- ated, cytokine-mediated host defense mechanism in mice against extraintestinally invasive ... antibodies directed against the O antigens of Gram-negative bacteria are highly protective [7,8] and that many of the licensed vaccines against bacterial pathogens are directed against th...
Ngày tải lên: 13/08/2014, 11:23
Báo cáo y học: " FISH Oracle: a web server for flexible visualization of DNA copy number data in a genomic contex" ppsx
... 5(4):557-572. 42. Sakakura C, Mori T, Sakabe T, Ariyama Y, Shinomiya T, Date K, Hagiwara A, Yamaguchi T, Takahashi T, Nakamura Y, Abe T, Inazawa J: Gains, losses, and amplifications of genomic materials in primary ... copy number data including classical array CGH tiling microarrays or SNP microarrays. Although a number of software tools for array CGH analysis and visualization...
Ngày tải lên: 10/08/2014, 09:22
Báo cáo y học: "Generation of a single pulmonary pressure-volume curve does not durably affect oxygenation in patients with acute respiratory distress syndrome" docx
... affect oxygenation in patients with acute respiratory distress syndrome Antoine Roch, Jean-Marie Forel, Didier Demory, Jean-Michel Arnal, Stéphane Donati, Marc Gainnier and Laurent Papazian Service ... super syringe technique. Variables were expressed as mean ± standard deviation. A two-way analysis of variance (ANOVA) for repeated measures was conducted to study the effects o...
Ngày tải lên: 12/08/2014, 23:23
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... study, performed the statistical analysis and Figure 4 Eosinophil cell count and C-reactive protein level for comparison of systemic inflammatory response syndrome and infection (P < 0Eosinophil ... samples were drawn into green-top vacutainer tubes containing lithium- heparin as anticoagulant. Plasma CRP was also measured by immunoturbidimetry using the analyzer Cobas Integra...
Ngày tải lên: 25/10/2012, 10:35
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... unleashing NMDA and AMPA excitotoxic injury. Thus a mecha- nism by which abnormal energy metabolism may have an influence on clinical ALS is through depletion of Vgf neuroprotection against ... Chakraborty TR, Tkalych O, Nanno D, Garcia AL, Devi LA, Salton SR. Quantification of Vgf- and pro-SAAS-derived pep- tides in endocrine tissues and the brain, and their regulation by...
Ngày tải lên: 03/11/2012, 10:52
Báo cáo y học: "Chromothripsis is a common mechanism driving genomic rearrangements in primary and metastatic colorectal cancer" pdf
... predominantly in the primary tumor genome before initiation of metastasis [9]. In line with this hypothesis is the finding that distinct clonal cell populations in primary pancreatic carcinoma can ... bioinformatic analysis of array data. OP performed the breakpoint sequencing and analyzed the data. MT generated mate-pair libraries. IR performed SOLiD sequencing and genera...
Ngày tải lên: 09/08/2014, 23:20
Báo cáo y học: "Escape is a more common mechanism than avidity reduction for evasion of CD8+ T cell responses in primary human" pdf
... recent study also reported a relationship between T cell avidity and polyfunctionality, finding that high avid- ity HIV-specific T cells are typically polyfunctional and capable of mediating potent ... study and oversaw the analysis of the viral sequence data; and PB conceived of, designed and co-ordinated the study, contributed to data analysis and helped to draft the manuscr...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: " MDM2 is a novel E3 ligase for HIV-1 Vif" pot
... Shirakawa K, Takaori-Kondo A, Kobayashi M, Tomonaga M, Izumi T, Fukunaga K, Sasada A, Abudu A, Miyauchi Y, Akari H: Ubiquitina- tion of APOBEC3 proteins by the Vif-Cullin5-ElonginB- ElonginC ... University, 54 Shogoin-Kawaracho, Sakyo-ku, Kyoto 606-8507, Japan, 7 Central Pharmaceutical Research Institute, Japan Tobacco Inc., 1-1 Murasaki-cho, Takatsuki, Osaka 569-1125, Japan, 8 Laborat...
Ngày tải lên: 13/08/2014, 05:21