0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "Asthma is a risk factor for acute chest syndrome and cerebral vascular accidents in children with sickle cell disease" ppt

Báo cáo y học:

Báo cáo y học: "Asthma is a risk factor for acute chest syndrome and cerebral vascular accidents in children with sickle cell disease" ppt

... CentralPage 1 of 5(page number not for citation purposes)Clinical and Molecular AllergyOpen AccessResearchAsthma is a risk factor for acute chest syndrome and cerebral vascular accidents in ... that recent and recurrent episodes of acute chest syndrome are risk factors for cerebral vascular accidents [10]. Our findings of increased cerebral vascular accidents in patients with sickle cell ... retrospective chart analysis was performed investigating 48 children ages 3–18 years with asthma and sickle cell disease and 48 children with sickle cell disease alone. Children were matched for age, gender,...
  • 5
  • 288
  • 0
Báo cáo y học:

Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx

... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... features include dextrocardia, L-transposition of the great arteries, abdominal situs inversus, bilateral (a) t TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... heterotaxy and is consistent with a laterality disorder. In Xenopus, Shroom3 is expressed in the myocardium and is necessary for cellular morphogenesis in the early heart as well as normal cardiac...
  • 36
  • 446
  • 0
Báo cáo y học:

Báo cáo y học: "What is a virulence factor" pot

... Seguin M, Yuan L, Kelly N, Hammack C, SadoffJ, Gemski P Jr.: The importance of a lipopolysaccharide-initi-ated, cytokine-mediated host defense mechanism in miceagainst extraintestinally invasive ... antibodies directed against the Oantigens of Gram-negative bacteria are highly protective [7,8] and that many of the licensed vaccines against bacterialpathogens are directed against the capsular ... bacterial virulence factor by itself to initiate disease.Finally, the importance of the O antigen and capsularpolysaccharides as virulence determinants can be demon-strated by the fact that...
  • 2
  • 332
  • 0
Báo cáo y học:

Báo cáo y học: " FISH Oracle: a web server for flexible visualization of DNA copy number data in a genomic contex" ppsx

... 5(4):557-572.42. Sakakura C, Mori T, Sakabe T, Ariyama Y, Shinomiya T, Date K, Hagiwara A, Yamaguchi T, Takahashi T, Nakamura Y, Abe T, Inazawa J: Gains, losses, and amplifications of genomic materials in primary ... copy number dataincluding classical array CGH tiling microarrays or SNPmicroarrays. Although a number of software tools for array CGH analysis and visualization are available —both from academia ... for visualizing and analyzing array CGH data. Interestingly, except for waviCGH, all web-based software tools for array CGHdata analysis have been published in the mid-2000s.However, waviCGH,...
  • 12
  • 455
  • 0
Báo cáo y học:

Báo cáo y học: "Generation of a single pulmonary pressure-volume curve does not durably affect oxygenation in patients with acute respiratory distress syndrome" docx

... affect oxygenation in patients with acute respiratory distress syndrome Antoine Roch, Jean-Marie Forel, Didier Demory, Jean-Michel Arnal, Stéphane Donati, Marc Gainnier and Laurent PapazianService ... super syringetechnique.Variables were expressed as mean ± standard deviation. A two-way analysis of variance (ANOVA) for repeated measureswas conducted to study the effects of time and PV measure-ment ... a single staticPV measurement on gas exchange and haemodynamics; the PVmeasurements were taken using a super syringe and by usingthe constant flow method in patients with acute respiratorydistress...
  • 5
  • 314
  • 0
Báo cáo y học:

Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"

... study, performed the statistical analysis and Figure 4Eosinophil cell count and C-reactive protein level for comparison of systemic inflammatory response syndrome and infection (P < 0Eosinophil ... sampleswere drawn into green-top vacutainer tubes containing lithium-heparin as anticoagulant. Plasma CRP was also measured byimmunoturbidimetry using the analyzer Cobas Integra (RocheDiagnostics, ... mortalityrelated to sepsis conditions vary between 28% and 54%.Eosinopenia was a sepsis marker in our study. The study by Gil and colleagues in a department of internal medicine showedthat an inflammatory...
  • 10
  • 597
  • 0
Báo cáo y học:

Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

... unleashing NMDA and AMPA excitotoxic injury. Thus a mecha-nism by which abnormal energy metabolism may have an influence on clinical ALS is through depletion of Vgf neuroprotection against ... Chakraborty TR, Tkalych O, Nanno D, Garcia AL, Devi LA, Salton SR. Quantification of Vgf- and pro-SAAS-derived pep-tides in endocrine tissues and the brain, and their regulation by diet and ... Acad Sci USA 2006; 103(39): 14584-14589. 16. Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N. Peptidomic...
  • 8
  • 499
  • 0
Báo cáo y học:

Báo cáo y học: "Chromothripsis is a common mechanism driving genomic rearrangements in primary and metastatic colorectal cancer" pdf

... predominantly in the primary tumor genome before initiation of metastasis [9]. In line with this hypothesis is the finding that distinct clonal cell populations in primary pancreatic carcinoma can ... bioinformatic analysis of array data. OP performed the breakpoint sequencing and analyzed the data. MT generated mate-pair libraries. IR performed SOLiD sequencing and generated fragment libraries. ... pairwise comparison of somatic variations in primary and metastatic samples indicated that many chromothripsis clusters, isolated rearrangements and point mutations are exclusively present in...
  • 29
  • 405
  • 0
Báo cáo y học:

Báo cáo y học: "Escape is a more common mechanism than avidity reduction for evasion of CD8+ T cell responses in primary human" pdf

... recent study also reported a relationship between T cell avidity and polyfunctionality, finding that high avid-ity HIV-specific T cells are typically polyfunctional and capable of mediating potent ... study and oversaw the analysis of theviral sequence data; and PB conceived of, designed and co-ordinated thestudy, contributed to data analysis and helped to draft the manuscript. Allauthors ... Briefly, HIV-1 RNAwas isolated from plasma using a QIAamp viral RNAmini kit (QIAGEN), and cDNA was synthesized fromreplicate plasma virus RNA preparations using Super-Script III reverse transcriptase...
  • 13
  • 370
  • 0
Báo cáo y học:

Báo cáo y học: " MDM2 is a novel E3 ligase for HIV-1 Vif" pot

... Shirakawa K, Takaori-Kondo A, Kobayashi M, Tomonaga M, Izumi T,Fukunaga K, Sasada A, Abudu A, Miyauchi Y, Akari H: Ubiquitina-tion of APOBEC3 proteins by the Vif-Cullin5-ElonginB-ElonginC ... University, 54 Shogoin-Kawaracho, Sakyo-ku, Kyoto 606-8507, Japan, 7Central Pharmaceutical Research Institute, Japan Tobacco Inc., 1-1 Murasaki-cho, Takatsuki, Osaka 569-1125, Japan, 8Laboratory ... (activation-induced cytidine deaminase),APOBEC3 (A- H), and APOBEC4 [4]. A3 G is incorporatedinto HIV-1 virions and inhibits HIV-1 replication byinducing G-to -A hypermutation in viral cDNA duringreverse...
  • 12
  • 692
  • 0

Xem thêm

Từ khóa: what is the role of neuroimaging in acute stroke in children with sickle cell diseasewhat is the role of neuroimaging in prevention of recurrent ischemic stroke in children with sickle cell diseaseis a risk factor for atherosclerosis and liver fibrosisbáo cáo y họcbáo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyene sherril d l 2004 asthma as a risk foctor for copd in a longitudinal study chest 126 pp 59 65diabetes and coronary heart disease a risk factor for the global epidemica risk factor for future cardiovascular diseasea risk factor for coronary heart diseasenrf2 mafk is a responsive factor for gpe1 enhancer activitytype ii diabetes as a risk factor for pancreatic ductal adenocarcinomaBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam