Báo cáo y học: "Circulating immune complexes and complement C3 and C4 levels in a selected group of patients with rhinitis in Lebanon" pot
... (65.5%). Dermatophagoides pteronyssinus (Dpt) was the causative allergen in 62, Dermatophagoides farinae (Df) in 58, cat hair dander in 23 and dog hair dander in 9 patients (some patients were allergic ... because C3 and C4 levels were within the normal range in all patients tested (Table 1). In support of the lack of involvement of the classical and lectin...
Ngày tải lên: 13/08/2014, 13:22
... candidate autoantigens in RA, including protein and overlapping pep- tides representing native and citrullinated fibrinogen. Synovial microarray analysis demonstrated targeting of citrullinated fibrinogen ... Kurokawa T, Hara S, Takahara H, Sugawara K, Ikenaka T: Conver- sion of peanut trypsin-chymotrypsin inhibitor B-III to a chymo- trypsin inhibitor by deimination of the P1 ar...
Ngày tải lên: 09/08/2014, 10:23
... hydroxyl radicals that cause damage to protein, RNA and DNA that are not repairable by cellular mechanisms thus initiating the malignant process Gradual increase of copper levels from precancer ... Iron and Selenium) as markers in oral precancer and cancer : a randomised, controlled clinical trial Sunali S Khanna* 1 and Freny R Karjodkar 2 Address: 1 Department of Oral M...
Ngày tải lên: 11/08/2014, 23:22
Báo cáo y học: "Circulating surfactant protein -D is low and correlates negatively with systemic inflammation in early, untreated rheumatoid arthritis" pps
... GL drafted the manuscript. KJ carried out the immunoassays and gel filtration chromatography. AGJ and AV evaluated the x-ray data. All authors read and approved the final manuscript. Competing interests The ... inverse association between SP-D and disease activity measures and by the gradual SP-D increase during treatment. The inverse association of SP-D and inflammatory signs...
Ngày tải lên: 12/08/2014, 12:20
Báo cáo y học: "Circulating RANKL is inversely related to RANKL mRNA levels in bone in osteoarthritic males" potx
... forward: ACCCAGAAGACTGTGGATGG; GAPDH, reverse: CAGTGAGCTTCCCGTTCAG; OPG, for- ward: CTGTTTTCACAGAGGTCAATATCTT; OPG, reverse: GCTCACAAGAACAGACTTTCCAG; and RANKL, forward: CCAAGATCTCCAACATGACT; and ... Hikita A, Yana I, Wakeyama H, Nakamura M, Kadono Y, Oshima Y, Nakamura K, Seiki M, Tanaka S: Negative regulation of osteo- clastogenesis by ectodomain shedding of receptor activator...
Ngày tải lên: 09/08/2014, 10:22
Báo cáo y học: "The human urinary proteome contains more than 1500 proteins, including a large proportion of membrane proteins" pptx
... methio- nine and protein N-acetylation and deamidation of asparag- ine and glutamine were searched as variable modifications. Initial mass tolerances for protein identification on MS peaks were ... compounds Glycosaminoglycan binding Polysaccharide binding Hydrolase activity, acting on glycosyl bonds GTPase activity Pattern binding Serine-type endopeptidase activity Electron transport...
Ngày tải lên: 14/08/2014, 17:22
Báo cáo y học: "Extracorporeal immune therapy with immobilized agonistic anti-Fas antibodies leads to transient reduction of circulating neutrophil numbers and limits tissue damage after hemorrhagic shock/resuscitation in a porcine model" doc
... base excess; creatinine [mg/dl]; AST [U/l]: aspartate aminotransaminase; ALT [U/l]: alanine aminotransaminase; CK [U/l]: creatine phosphokinase; CK-MB [U/l]: „MB"-type isoenzyme of creatine ... was in charge of he statistical evaluation. MSch conceived of the study, and participated in its design and coordination and draft the manuscript. All authors read and approved...
Ngày tải lên: 11/08/2014, 03:20
Báo cáo y học: "Circulating adenosine increases during human experimental endotoxemia but blockade of its receptor does not influence the immune response and subsequent organ injury" pdf
... range]) and were analyzed with one-way analysis of variance (ANOVA). The probability values refer to the significant increase in circulating cytokines for each group, as analyzed with repeated measures ... resulted in a marked increase in the urinary excretion of markers of proximal and distal tubular damage. Data are expressed as percentage increase in time after LPS...
Ngày tải lên: 14/08/2014, 07:21
Báo cáo y học: "Neural immune pathways and their connection to inflammatory diseases" ppsx
... associated with increased susceptibility to autoimmune/inflammatory disease in a variety of animal models and human studies. In general, at the baseline the HPA axis parameters do not differ in indi- viduals ... Delgado M, Abad C, Martinez C, Juarranz MG, Arranz A, Gomariz RP, Leceta J: Vasoactive intestinal peptide in the immune system: potential therapeutic role in infl...
Ngày tải lên: 09/08/2014, 01:23