Báo cáo y học: "Delays in childhood immunization in a conflict area: a study from Sierra Leone during civil war" pot

Báo cáo y học: "Delays in childhood immunization in a conflict area: a study from Sierra Leone during civil war" pot

Báo cáo y học: "Delays in childhood immunization in a conflict area: a study from Sierra Leone during civil war" pot

... full age- appropriate immunization in a Sierra Leonean commu- nity exposed to war-related hostilities while up-to-date immunization was maintained. This indicates that many of the missed vaccinations ... strengths In general, systematically collected health data of popula- tions living in conflict areas are scarce [14]. Consequently, little is known about immunization covera...

Ngày tải lên: 13/08/2014, 13:21

8 173 0
Báo cáo y học: "The relationship between CD4+CD25+CD127regulatory T cells and inflammatory response and outcome during shock states" potx

Báo cáo y học: "The relationship between CD4+CD25+CD127regulatory T cells and inflammatory response and outcome during shock states" potx

... ‘immune paraly- sis’ or ‘leukocyte reprogramming’ and is characterized by a lymphocytes’ anergy, apoptosis, and a reduced capacity to present antigens [5]. Several mechanisms may partly explain this ... obvious from an immunological standpoint. Indeed, after having considered for years the host response to severe infection only as a stormy inflammatory reaction, it appears now that an...

Ngày tải lên: 13/08/2014, 20:21

11 281 0
 Báo cáo y học: " Carotid Intima-media thickness in childhood and adolescent obesity relations to abdominal obesity, high triglyceride level and insulin resistance"

Báo cáo y học: " Carotid Intima-media thickness in childhood and adolescent obesity relations to abdominal obesity, high triglyceride level and insulin resistance"

... enzyme-linked immuno- sorbent assay method. Fasting plasma glucose (FPG) was measured by glucose oxidase method; fasting plasma insulin (FINS) was measured by radioim- munity assay (Modula Analytics ... Thereafter, associations were examined by Pearson correlation analysis for continuous variables, and by Spearman correlation analysis for categorical variables. Finally, Int. J. Med. Sci...

Ngày tải lên: 25/10/2012, 11:40

6 478 0
Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc

Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc

... ACGTTGGATGAGAGAACTGGGTTAAGGCAG rev ACGTTGGATGCCAGCACATCTTTTCACTCC ACTCCATACCACTGGTCAGCTG 93.81 ST+7 rs574174 G /A 0.19 0.19 fwd ACGTTGGATGCTGCCCTTGATGATTCCAAG rev ACGTTGGATGGGAACATCACAGGAAATGAC ACTGTCCCCATCCCATC ... ACGTTGGATGTTGCTCAGCCCCAAAGATGG CCCCACAGCCACTGGACAG 93.95 V4 rs2787094 C/G 0.22 0.23 fwd ACGTTGGATGAGAAACAGGAAGGAAGGTCC rev ACGTTGGATGTATGGTTCGACTGAGTCCAC CTGAGTCCACACTCCCCTG 93.8...

Ngày tải lên: 12/08/2014, 16:20

12 355 0
Báo cáo y học: "Surviving meningococcal septic shock in childhood: long-term overall outcome and the effect on health-related quality of life" ppt

Báo cáo y học: "Surviving meningococcal septic shock in childhood: long-term overall outcome and the effect on health-related quality of life" ppt

... contributions CMPB initiated this study and created the database, performed the statistical analysis and wrote the manuscript. LCACV assisted in creating the database, the interpretation of the results and ... 8 14. Taylor FB Jr, Toh CH, Hoots WK, Wada H, Levi M: Towards definition, clinical and laboratory criteria, and a scoring system for disseminated intravascular coagulation. Thro...

Ngày tải lên: 13/08/2014, 21:20

8 237 0
Báo cáo y học: "Clinical review: Medication errors in critical care"

Báo cáo y học: "Clinical review: Medication errors in critical care"

... Conversely, high-reliability organizations such as aircraft carriers, nuclear power plants, and air traffic controllers have markedly improved safety by standardizing practices and investing in safety ... medical care may not result in meaningful safety improvement. Instead, the approach of identifying failures and redesigning faulty systems appears to be a more promising way to reduce...

Ngày tải lên: 25/10/2012, 10:35

7 571 0
Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"

Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"

... oculopharyngeal muscular dystrophy. Clin Neurosci. 2003; 10: 125-7. 22. Orlacchio A, Gaudiello F, Totaro A, et al. A new SPG4 mutation in a variant form of spastic paraplegia with congenital arach- noid ... Microar- ray-based gene expression profiling and DNA copy number variation analysis of temporal fossa arachnoid cysts. Cerebro- spinal Fluid Research. 2010; 7: 6-13. 20. Hella...

Ngày tải lên: 25/10/2012, 11:00

4 652 0
Báo cáo y học: "Can Occult Cystobiliary Fistulas in Hepatic Hydatid Disease Be Predicted Before Surgery"

Báo cáo y học: "Can Occult Cystobiliary Fistulas in Hepatic Hydatid Disease Be Predicted Before Surgery"

... obstructive jaundice, intrahepatic cholestasis, and pancreatitis (31). GGT is more re- sponsive to biliary obstruction than are aspartate aminotransferase (AST) and alanine aminotransferase (ALT). ... patients had complaint of abdominal pain. On physical ex- amination a right upper quadrant mass was detected in 10 patients (14%); the other physical examination findings were normal. F...

Ngày tải lên: 25/10/2012, 11:00

6 389 0
Báo cáo y học: " Predictors of hepatic steatosis in HBeAg-negative chronic hepatitis B patients and their diagnostic values in hepatic fibrosis"

Báo cáo y học: " Predictors of hepatic steatosis in HBeAg-negative chronic hepatitis B patients and their diagnostic values in hepatic fibrosis"

... 5′-TGTCTCGTGTTACAGGCGGGGT-3', asymmetric primer 2 was 5′-GAGGCATAGCAGCAGGA GAAGAG-3', and fluorescent primer was 5′-TCGCTGGAAGTGTCTGCGGCGT-3'. Serum assays Fasting blood was collected ... glucose (FBG), insulin, triglyceride (TG), cholesterol (CHOL), ALT, aspartate amino- transferase (AST), γ-glutamyltransferase (GGT), alka- line phosphatases (ALP), albumin (Alb) and g...

Ngày tải lên: 25/10/2012, 11:48

6 606 0
 Báo cáo y học: "980 nm diode lasers in oral and facial practice: current state of the science and art"

Báo cáo y học: "980 nm diode lasers in oral and facial practice: current state of the science and art"

... developing very quickly. It is an instrument that achieves maximum oral health in a minimally invasive fashion. New Lasers with a wide range of characteristics are available today and are being ... 361 had healed without leaving any macroscopically visi- ble scars [Fig.2b,3b], after the appearance for half a day of erythema with moderate serum secretion and microcrasts for 5-7...

Ngày tải lên: 26/10/2012, 09:48

7 567 1
w