Báo cáo y học: "Down-regulation of kallikrein-related peptidase 5 (KLK5) expression in breast cancer patients: a biomarker for the differential diagnosis of breast lesions" doc

... the data. AS participated in the conception and design of the study, the analysis and the interpretation of the data, the statistical analysis and supervised the study. All authors read and approved ... CLINICAL PROTEOMICS Down-regulation of kallikrein-related peptidase 5 (KLK5) expression in breast cancer patients: a biomarker for the diff...

Ngày tải lên: 13/08/2014, 13:20

... NT00 759 2 forward GCACATCTACAATGCCTACCTGAA reverse CTCGATGTCGTGGATCACAAA PPARγ NM0 050 37 forward AAGTTCAATGCACTGGAATTAGATGA reverse TGTAGCAGGTTGTCTTGAATGTCTTC β-actin NM001101 forward GCCAACCGCGAGAAGATG reverse ... but only staining that reached a certain level of intensity. Statistical analysis All data sets were analysed by Kolmogorov Smirnov test and since the data for PCR expre...

Ngày tải lên: 12/08/2014, 18:20

... underlying etiology is non- rheumatic may portend a somewhat higher mortality. They showed a survival of 73% at 1 year and 65% at 5, 10, and 15 years. The youngest patient in our study was 6 years ... mortality was 5. 3% (6 patients, Table 4); late mortality occurred in 6 patients (Table 5) at a linearized rate of 0.67% per patient-year. The actuarial survival was 98.1%...

Ngày tải lên: 10/08/2014, 09:21

... developed ascending motor weakness and laboratory findings consistent with a diagnosis of Guillain-Barré syndrome. Plasmapheresis was initiated. Acute facial palsy developed during the plasma exchange ... recognized as a heterogeneous syndrome, different variants exist including demyelinating and axonal forms; the demyeli- nating variant is most common in the USA. Based on con...

Ngày tải lên: 11/08/2014, 03:21

... conceived the study and made a major contribution in the compilation, analysis, literature review and formatting of the manuscript, AK had a major contribution in the analysis and editing, RK helped in ... clin- ical parameters and other details are given in Table 1. Case 1 A 14-year-old Caucasian girl presented with a one-year history of cough and gradually progre...

Ngày tải lên: 11/08/2014, 03:21

... setting and characteristics may be different from everyday practice. The characteristics of the healthcare system in each coun- try (e.g., financing systems) may also be important when generalising ... negatively for the criterion 'blinded assessment of primary outcomes' Another source of bias may be the non-blinding of the healthcare providers. Because of t...

Ngày tải lên: 11/08/2014, 05:21

... dysgeusia, and an obvious facial droop appeared. The remainder of his neurological examination, including contralateral facial strength, remained unchanged. A brain magnetic resonance ima- ging ... though the remainder of his facial paralysis persisted. Because of the association of recurrent acute facial weakness during plasmapheresis, the therapy was dis- continued and a...

Ngày tải lên: 11/08/2014, 07:20

... subscale of an interpersonal problem area indicates a problem in adjusting in that area. The total range of scores for each problem area was divided into 3 intervals. The scores indicating the subjects’ ... problem areas were the scores above the sec- ondintervalthatwerecompatiblewiththeproblem areas diagnosed by the clinical interview. A statistical analysis was per...

Ngày tải lên: 11/08/2014, 16:22

... S, Fujii A, Takamatsu Y, Nakashima M, Watanabe T, Kawahara K, et al: Differential chemokine, chemokine receptor, cytokine and cytokine receptor expression in pulmonary adenocarcinoma: diffuse ... had caused disease outbreaks in chicken, ducks and pigs in many parts of the world including China, Germany, Hong Kong, Indonesia, Iran, Ireland, Israel, Italy, Jordan, Pakistan, Sau...

Ngày tải lên: 12/08/2014, 02:20

... findings because changes in ASM phenotype induced by cytokines may play a role in the airway remodeling and bronchial hyper-responsiveness that is observed in asthma. A better understanding of ... likely lead to new therapeu- tic approaches in the management of asthma. In ASM cells, activation of TNFR1 coupled to the TRAF2–NF-κB pathway ‘primes’ airway myocytes to au...

Ngày tải lên: 12/08/2014, 18:20