Báo cáo y học: "Adoptive transfer of splenocytes to study cell-mediated immune responses in hepatitis C infection using HCV transgenic mice" pptx
Báo cáo y học: "Adoptive transfer of splenocytes to study cell-mediated immune responses in hepatitis C infection using HCV transgenic mice" pptx
... 9:7 http://www.comparative-hepatology.com/content/9/1/7 Page 10 of 13 RESEA R C H Open Access Adoptive transfer of splenocytes to study cell-mediated immune responses in hepatitis C infection using HCV transgenic ... evaluated by adoptive transfers of carboxyfluorescein succinimidyl ester (CFSE) labelled splenocytes from HCV immunized mice into HCV t...
Ngày tải lên: 13/08/2014, 13:20
Báo cáo y học: " Early alterations of the innate and adaptive immune statuses in sepsis according to the type of underlying infection" docx
... B-lymphocytes decrease; in intraabdominal infections absolute counts of CD8-lym- phocytes and the rate of apoptosis of CD8-lymphocytes decrease; in primary bacteremia the rate of apoptosis of NKT cells ... expression of HLA-DR on monocytes, the rate of apoptosis of mono- cytes and the rate of apoptosis of NKT cells decrease; in CAP absolute counts of NK cells, CD4-...
Ngày tải lên: 13/08/2014, 20:22
Báo cáo y học: "Current Status of Methods to Assess Cancer Drug Resistance"
... transductors and thus act mainly cytostati- cally compared with classical cytotoxic drugs require special timing of scans [68]. International guidelines for PET tests are therefore necessary to ... effectiveness and toxicity of drugs. Since investi- gations using omics are dependent on cancer tissue, which is often only available before the commence- ment of therapy, only intrins...
Ngày tải lên: 25/10/2012, 11:10
Báo cáo y học: " Transcriptome analysis of murine thymocytes reveals age-associated changes in thymic gene expression"
... 3.2* CGAACCTTCCTGTCTA CTTGCT TTCCTTTGTTCTGGGCAATG chemokine (C- X -C motif) receptor 4 (Cxcr4) NM_009911 Cxcr4 1.82 1.75 1.72 3.5* TTGCCATGGAACCGA TCA TCCGTCATGCTCCTTAGCTT phosphoinosi- tide ... 4.52 3.42 NC AAGAGCGATGAGCAG TGGTT CCACGTTTTCAGGTCTTCGT cytochrome c oxidase subunit II (Cox2) AF378830 Cox2 3.07 3.66 3.25 NC TAATTGCTCTCCCCTC TCTACG CACCAGGTTTTAGGTCGTTTG annexin A...
Ngày tải lên: 03/11/2012, 11:35
Báo cáo Y học: Functional reconstitution of the HIV receptors CCR5 and CD4 in liposomes pot
... a recombinant protein containing the C- myc epitope followed by six histidines at the C- terminus. A plasmid containing the wild type version of CCR5 was constructed by introducing the coding sequence ... recombinant version was made containing a C- terminal myc tag followed by a His 6 sequence, by cloning the CCR5 gene into a pcDNA3.1 myc-his vector, and transfecting CHO cells with this...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo Y học: Differential regulation of the Fe-hydrogenase during anaerobic adaptation in the green alga Chlamydomonas reinhardtii pot
... oligonucleotide sequences were: HydNde (5¢- CATATGGCCGCACCCG CTGCGGAGGCGCCT-3¢), HydBam (5¢-CC GGATCC TCAAGCCTCTGGCGCTCCTCA-3¢). The hydA gene, corresponding to amino acids 57–497, was amplified, confi rmed by sequences ... amino-acid sequence a degenerate oligonucleo- tide Hyd5 [5¢-GCCGCCCC(GC )GC(GCT)GC(GCT)GA (AG)GC-3¢] was synthesized, t aking into account known C. reinhardtii amino-acid...
Ngày tải lên: 08/03/2014, 22:20
Báo cáo Y học: Distinct parts of minichromosome maintenance protein 2 associate with histone H3/H4 and RNA polymerase II holoenzyme pptx
... pGEX-MCM2(169–212) and pFLAG-MCM2(1–230) plasmids was conducted using the Quikchange site-direc- ted mutagenesis kit (Stratagene). 5¢-CCGCTTCAA GAACTTCCCGGGCACTCACGTCAC-3¢ was used as a primer to introduce ... subunit of RNA poly- merase II); GTF, general transcription factor; SMCC, SRB/ MED-containing cofactor; NAT, negative regulator of activated transcription; RLF-M, replication li...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo Y học: Functional integration of mitochondrial and hydrogenosomal ADP/ATP carriers in the Escherichia coli membrane reveals different biochemical characteristics for plants, mammals and anaerobic chytrids pdf
... 5¢-GGAAGTTACGAGGCTGACTTAGGC-3¢ aac1 (R.n.) Sense 5¢-GCGCCCGCGTTTCcatATGGGGGATCAG-3¢ Antisense 5¢-CCACACAATGGATCTGTGAACCTGTG-3¢ aac2 (R.n.) Sense 5¢-CTTTTTTGCTTTCcAtATGACAGATGCCG-3¢ Antisense 5¢-TACAACATGCCAGAtCtCGGGGAGAAC-3¢ hdgaac ... 5¢-TACAACATGCCAGAtCtCGGGGAGAAC-3¢ hdgaac (N.spec.) Sense 5¢-TTCCCCATATCCcAtATGGCCCAAAAG-3¢ Antisense 5¢-GCATTCGTTTAGTTCTTAATTCTCCAG-3¢ Ó FEBS 2002 Functional i...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo Y học: Kinetic studies of human tyrosyl-DNA phosphodiesterase, an enzyme in the topoisomerase I DNA repair pathway pot
... enzymatic activity was examined by determining the speci c activity of TDP by following the cleavage of 1 m M of substrate by 0.125 l M of enzyme in reaction buffer containing increasing concentrations ... Similarly, oligonucleotides of 5¢-AAGTAT AACTCTCGAGCCCTCCACATCAAGG-3¢ and 5¢-GG AGGGCACCCACATGTTCCCATGC-3¢ were used as primers to generate the huTDPND174 variant. Generation...
Ngày tải lên: 31/03/2014, 21:21
Báo cáo Y học: NMR structure of the HIV-1 regulatory protein Vpr in H2O/trifluoroethanol Comparison with the Vpr N-terminal (1–51) and C-terminal (52–96) domains pot
... cytostatic effect of Vpr occurs by inhibiting the activation of p34cdc-cyclin B, and thus contributes to the immunopathogenicity of HIV [20]. Another cytotoxic effect of Vpr is its capacity to ... domain of Vpr forms a complex with the second zinc finger of the nucleocapsid protein NCp7 [7,8]. In vivo, the incorporation of Vpr into mature HIV-1 particles seems to occur by...
Ngày tải lên: 31/03/2014, 23:20