Báo cáo y học: " Distribution of hepatitis C virus genotypes

Báo cáo y học: " Distribution of hepatitis C virus genotypes in patients infected by different sources and its correlation with clinical and virological parameters: a preliminary study" pptx

... for citation purposes) Comparative Hepatology Open Access Research Distribution of hepatitis C virus genotypes in patients infected by different sources and its correlation with clinical and virological ... genotypes and associated risk factors in hepatitis C virus (HCV) infected patients in Iran is limited. The aim of this study was t...

Ngày tải lên : 13/08/2014, 13:20

6
337
0

Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"

... donors) in Chile and was found in all infected patients with hepatocarcinoma in one study. [5] This same genotype was also found in 82% of 147 chronic hepatitis C patients in Chile as well. ... Ippolito F, Costantino A, Rapicetta M, Lecce R, Taliani G. High prevalence of hepatitis C virus infection in a small central Italian town: lack of evidence...

Ngày tải lên : 02/11/2012, 09:56

6
486
0

Báo cáo y học: " Kinetics of hepatitis C virus RNA load during pegylated interferon alpha-2a and ribavirin treatment in naïve genotype 1 patients" potx

... Kobayashi K, Kiyosawa K, Hayashi N, Tsuji T, Sata M, Origasa H, Iino S: Serum HCV RNA levels during early phase of recombinant interferon alfa- 2a (Roferon A) therapy for chronic hepatitis C and ... K, Kuwata Y, Yamazaki K, Sato T, Ohmura T, Matsushima T: Hepatitis C virus genotypes and hepatic fibrosis regulate 24-h decline of serum hepatitis C virus RNA during...

Ngày tải lên : 13/08/2014, 13:20

5
322
0

Báo cáo khoa học: "Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc

... Ndako* - ndakoj@yahoo.co.uk; Georgebest O Echeonwu - gon612echeonwu@yahoo.com; Nathaniel N Shidali - shidalinn@yahoo.com; Iliyasu A Bichi - iliyasubichi@yahoo.com; Grace A Paul - graceabu@yahoo.com; ... 1 Department of Virology, Federal College of Veterinary and Medical Laboratory Technology, Vom, Nigeria and 2 Department of Medical Laboratory Sciences, University of Maidu...

Ngày tải lên : 12/08/2014, 04:21

5
463
0

Báo cáo khoa học: " Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc

... Statistical analysis. GE Participated in drafting of the study design. NS Participated in study coordination. GP Participated in Data collection. EO Contributed in data analysis. LA Par- ticipated ... clinical characteristics, demographic characteristics and social behaviors, which could be possi- ble risk factors to acquiring HCV. Statistical Analysis General descriptive analys...

Ngày tải lên : 12/08/2014, 04:22

5
209
0

Báo cáo y học: " Seropositivity of Hepatitis B virus and Hepatitis C virus dual Infection among blood donors in Nyala Teaching Hospital" pot

... V: Comparative study on the clinical and virological characteristics among patients with single occult hepatitis B virus (HBV), single occult hepatitis C virus (HCV) and occult HBV and HCV ... S, Xie WF: A meta-analysis of case control stud- ies on the combined effect of hepatitis B and C virus infec- tions in causing hepatocellular carcinoma in China...

Ngày tải lên : 12/08/2014, 04:21

2
348
0

$Báo cáo khoa hoc:" Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo" ppt$

Báo cáo khoa hoc:" Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo" ppt

... (5'-gcgcgcactagtgccagccccctgatgggggcgacac-3') and reverse (5'-gcgcgcactagtttacaatttggactttccgcccttc-3') oligonucleotides, and transferred to the XbaI/BamHI sites of pRL-CMV vector ... sequence (5'accgtggagtgggggggcaggaggggctcagggagaaagtgcatacagccc ctggccctctctgcccttccgtcccctgt ttttc-3') (Promega). The Rluc:miR-328 binding site reporter constructs, in whic...

Ngày tải lên : 11/08/2014, 07:21

13
362
0

Báo cáo khoa hoc:" Recurrence of hepatitis C virus during leucocytopenia and spontaneous clearance after recovery from cytopenia: a case report" pot

... cytopenia-induced HCV recurrence. With recovery of leucocytes the virus was again cleared spontaneously. These findings suggest that agranulocytosis can lead to reactivation of hepatitis C virus and ... laboratory findings with elevated lipase and concomitant abdominal pain, an endoscopic retrograde cholangiopancreatogra- phy (ERCP) was performed. Trapped air in CT scan...

Ngày tải lên : 11/08/2014, 10:22

3
232
0

Báo cáo y học: " Prevalence of hepatitis delta virus infection among hepatitis b virus surface antigen positive patients circulating in the largest province of pakistan" pptx

... 729-748 (5’ -CAACATTCCGAGGGGA CCGT-3’) and inner a ntisense primers nucleotides 846- 865 (5 ’-GAAGGAAGGCCCTCGAGAACAAGA-3’) [11]. Standard precautions to avoid contamination during PCR were taken. Positive ... Zunaira Awan 2 , Aaliyah Tariq 2 , Khalida Parveen 1 Abstract Background: Hepatitis delta virus (HDV) and Hepatitis B virus (HBV) co-infection is well known to induce a s...

Ngày tải lên : 12/08/2014, 01:22

5
315
1

Báo cáo y học: " Characterization of Hepatitis B virus (HBV) genotypes in patients from Rondônia, Brazil" doc

... State population with clinical data to character- ize their HBV status (carrier, immunotolerancy, acute and chronic hepatitis, cirrhosis and/ or hepatocellular carcinoma). Santos et al. Virology ... (Paraná, Santa Catarina and Rio Grande do Sul states). South Region inhabitants latter migrate to Center West and Amazon states, including Rondônia. A deeper characterization of h...

Ngày tải lên : 12/08/2014, 02:20

7
533
0