Báo cáo y học: " Kinetics of hepatitis C virus RNA load during pegylated interferon alpha-2a and ribavirin treatment in naïve genotype 1 patients" potx

... Tanabe Y, Nawata H: Decline of hepatitis C virus load in serum during the first 24 h after administration of inter- feron-beta as a predictor of the efficacy of therapy. J Hepatol 20 01, 34 (1) :10 0 -10 7. 13 . ... treatment outcome in combination of high-dose inter- feron induction vs. pegylated interferon plus ribavirin for naive patients infected with he...

Ngày tải lên: 13/08/2014, 13:20

... Brechot C, Lamas E. Prevalence and genotypes of hepatitis C virus in blood donors and in patients with Int. J. Med. Sci. 2006, 3 41 International Journal of Medical Sciences ISSN 14 49 -19 07 ... hepatocarcinoma in one study. [5] This same genotype was also found in 82% of 14 7 chronic hepatitis C patients in Chile as well. [48] Genotype 1b is also...

Ngày tải lên: 02/11/2012, 09:56

... association between the places of infection of the patients and geno- type. However, genotype 4 was found only in north and west of country and mixed infection with genotype 1a and 1b only in center. ... splenomegaly, ascitis, edema, cirrhosis, grade and stage of liver biopsy, and child score and status (inactive, chronic, cirrhotic and active) of the disease...

Ngày tải lên: 13/08/2014, 13:20

... hepatitis C virus (HCV) and occult HBV and HCV dual infection. Journal of Medical Virology 2007, 79:236-2 41. 10 . Liu Z, Hou J: Hepatitis B virus (HBV) and hepatitis C virus (HCV) dual infection. International ... Journal of Medical Science 2006, 3:57-62. 11 . Shi J, Zhu L, Liu S, Xie WF: A meta-analysis of case control stud- ies on the combined effect of he...

Ngày tải lên: 12/08/2014, 04:21

... The IRES 1- 515 /Fluc unit was then reamplified by PCR using forward (5'-gcgcgcactagtgccagccccctgatgggggcgacac-3') and reverse (5'-gcgcgcactagtttacaatttggactttccgcccttc-3') oligonucleotides, ... expression vector was conceived by cloning in psiSTRIKE the pre-mmu-miR-328 sequence (5'accgtggagtgggggggcaggaggggctcagggagaaagtgcatacagccc ctggccctctctgcccttccgtcccctgt...

Ngày tải lên: 11/08/2014, 07:21

... recovery of leucocytes the virus was again cleared spontaneously. These findings suggest that agranulocytosis can lead to reactivation of hepatitis C virus and that recovery from hepatitis C ... by liver function deterioration and reappearance of HCV -RNA. Propylthiouracil was discontinued and his leukocyte counts increased. Twenty-eight weeks after onset of acute h...

Ngày tải lên: 11/08/2014, 10:22

... PCR reaction mixture (2.5 mM MgCl2, a 10 0 μM concentration of each of the four deoxynucleotides (dNTPs), 10 pM of each outer sense nucleotides 695- 718 {5’-CATGGTCCCAGCCTCCT CGCTGGC-3’ }and outer ... liver cells are previously been infected by hepatitis B virus. HDV co-infection or super infection leads to the cirrho- sis of the liver and finally hepatocellular carcinoma (H...

Ngày tải lên: 12/08/2014, 01:22

... recently reported the pre- sence of this genotype in a specific community in Colombia [11 ] and in the north of India [12 ]. Genotype * Correspondence: monica.viviana@usp.br 2 Laboratory of Gastroenterology ... and asialoglycoprotein receptor on hepatocytes may be indispensable for viral binding and entry. J Viral Hepat 2006, 13 :11 -18 . 5. McMahon BJ: The natural hist...

Ngày tải lên: 12/08/2014, 02:20

... 5). Considering the duration of diabetes condition among subjects recruited, in this study, participants were grouped into: 1 10 years, 11 15 years, and 16 years above. Those with 1 10 years of ... sub- jects, which covers clinical characteristics, demographic characteristics and social behaviors, which could be possi- ble risk factors to acquiring HCV. Statistical Analysis Gene...

Ngày tải lên: 12/08/2014, 04:21

... Pirlich M, Balks HJ, Selberg O: Glucose intolerance in liver cirrhosis: role of hepatic and non-hepatic influences. Eur J Clin Chem Clin Biochem 19 94, 32 (10 ):749-58. 9. Del Vecchio Blanco C, Gentile ... sub- jects, which covers clinical characteristics, demographic characteristics and social behaviors, which could be possi- ble risk factors to acquiring HCV. Statistical Analysis...

Ngày tải lên: 12/08/2014, 04:22