Báo cáo y học: "Differential expression of copper-associated and oxidative stress related proteins in a new variant of copper toxicosis in Doberman pinscher" potx

Báo cáo y học: "The human urinary proteome contains more than 1500 proteins, including a large proportion of membrane proteins" pptx

Báo cáo y học: "The human urinary proteome contains more than 1500 proteins, including a large proportion of membrane proteins" pptx

... samples 1 and 2, and pooled sample). Origin of proteins in the urine Our analysis revealed that extracellular proteins, plasma membrane proteins, and lysosomal proteins are enriched in the urine, ... methio- nine and protein N-acetylation and deamidation of asparag- ine and glutamine were searched as variable modifications. Initial mass tolerances for protein identif...
Ngày tải lên : 14/08/2014, 17:22
  • 16
  • 361
  • 0
Báo cáo y học: "Differential expression of the angiogenic Tie receptor family in arthritic and normal synovial tissue" doc

Báo cáo y học: "Differential expression of the angiogenic Tie receptor family in arthritic and normal synovial tissue" doc

... primers Ang-1 GCC ATT ACC AGT CAG AGG CAG T CAT GCT AAG AAT TGA GTT AAT AAT AGG CTC GGT TCC CTT CC Ang-2 CGC TCG AAT ACG ATG ACT CG TGC AGA GGC TGC AAG TGC TGG AGA A CCA CTG AGT GTT GTT TTC CAT GAT Tie1 ... blot analysis. In RA, Ang-1 positive immunostaining on lining cells, macrophages and endothelial cells was significantly higher than in OA and normal synovial tissue. The expres...
Ngày tải lên : 09/08/2014, 03:24
  • 9
  • 424
  • 0
Báo cáo y học: "Differential expression of chemokine receptors on peripheral blood B cells from patients with rheumatoid arthritis and systemic lupus erythematosus" ppsx

Báo cáo y học: "Differential expression of chemokine receptors on peripheral blood B cells from patients with rheumatoid arthritis and systemic lupus erythematosus" ppsx

... in patients with RA. Correlation factor (Spearman's) and P value are indicated (GraphPad software). Figure 9 CXCL10 concentrations in seraCXCL10 concentrations in sera. Sera of healthy ... direct lymphocytes into the chronically inflamed synovial tissue [7,8]. Both the residual synovial-lining cells and infiltrating leuko- cytes are the source of pro-inflammatory chemokine...
Ngày tải lên : 09/08/2014, 06:23
  • 13
  • 504
  • 0
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps

Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps

... GCGATGGTCTCAGAAACCAAAC Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA GRβ Forward primer: AAC TGG CAG CGG TTT TAT CAA CT Reverse primer: AACTCTTGGATTCTATGCATGAAAATGTTA TGTGGTTA Probe: ... ATGGTGAATATCATCATGAAAAAGATTC Probe: CATGCTCATTCTCAACCACATCACCAACA H6PDH Forward primer: CAGGTGTCCTAGTGCACATTGAC Reverse primer: GTAGCCCACTCTCTCGTCCAA Probe: AAGGCACGCCCTCCCAGCG...
Ngày tải lên : 09/08/2014, 08:22
  • 10
  • 438
  • 0
Báo cáo y học: "Differential expression of RANK, RANK-L, and osteoprotegerin by synovial fluid neutrophils from patients with rheumatoid arthritis and by healthy human blood neutrophils" doc

Báo cáo y học: "Differential expression of RANK, RANK-L, and osteoprotegerin by synovial fluid neutrophils from patients with rheumatoid arthritis and by healthy human blood neutrophils" doc

... molecu- lar biology and evaluated data. A- AM carried out the immu- noassays and evaluated data. All authors read and approved the final manuscript. Acknowledgements We thank Marie-Lisane Tremblay for her ... assay, Western blotting, and cytofluorometry. RANK signaling was analyzed by the degradation of inhibitor of kappaB-alpha (I-κB-α). SF neutrophils from patients with RA expr...
Ngày tải lên : 09/08/2014, 10:20
  • 12
  • 477
  • 0
Báo cáo y học: "Differential expression of the FAK family kinases in rheumatoid arthritis and osteoarthritis synovial tissues" doc

Báo cáo y học: "Differential expression of the FAK family kinases in rheumatoid arthritis and osteoarthritis synovial tissues" doc

... probably as a result of inflammation in RA ST. Focal adhesion kinase (FAK) and proline-rich tyrosine kinase (Pyk)2 are two members of a family of nonreceptor protein tyrosine kinases that are acti- vated ... the colocalization and activation of FAK, Pyk2, Src and paxillin in RA and OA patient's ST lining and sublining may be important for integrin-mediated signa...
Ngày tải lên : 09/08/2014, 10:21
  • 10
  • 393
  • 0
Báo cáo y học: "Differential expression of interferon-induced microRNAs in patients with chronic hepatitis C virus infection treated with pegylated interferon alpha" potx

Báo cáo y học: "Differential expression of interferon-induced microRNAs in patients with chronic hepatitis C virus infection treated with pegylated interferon alpha" potx

... healthy individuals, and that their expres- sion in such cells may be induced by IFN -alpha to vary- ing degrees. Specifically, greater increases in miR-1 and miR-128 and a lower increase in ... to prominence as critical regulators in a wide array of mechanisms of cell physiology. There is increasing evi- dence that miRNAs may also have an important func- tion in viral...
Ngày tải lên : 12/08/2014, 02:20
  • 9
  • 336
  • 0
Báo cáo y học: " Differential expression and function of breast regression protein 39 (BRP-39) in murine models of subacute cigarette smoke exposure and allergic airway inflammation" pps

Báo cáo y học: " Differential expression and function of breast regression protein 39 (BRP-39) in murine models of subacute cigarette smoke exposure and allergic airway inflammation" pps

... enzymatically active and inactive chitinases, acidic mammalian chiti- nase (AMCase) and BRP-39 have been shown to be cru- cial in murine models of allergic inflammation. Specifically, BRP-39 and AMCase ... inflammatory conditions and has been debated as a biomarker of certain disease states, relatively little investigation into its relevance in inflammatory responses has bee...
Ngày tải lên : 12/08/2014, 13:22
  • 12
  • 307
  • 0
Báo cáo y học: " Differential expression of Toll-like receptors on human alveolar macrophages and autologous peripheral monocytes" pdf

Báo cáo y học: " Differential expression of Toll-like receptors on human alveolar macrophages and autologous peripheral monocytes" pdf

... macrophages and monocytes. Alveolar macrophages and monocytes from healthy donors were analyzed by flow cytometry using phycoerythrin (PE)-coupled mouse anti-TLR2, TLR4 and TLR9 antibodies and their ... suggesting that activation via TLR4 may result in differential cyto- kine production from alveolar macrophages and mono- cytes. This observation may find a mechanistic explanatio...
Ngày tải lên : 12/08/2014, 14:20
  • 13
  • 251
  • 0
Báo cáo y học: "Differential expression of copper-associated and oxidative stress related proteins in a new variant of copper toxicosis in Doberman pinscher" potx

Báo cáo y học: "Differential expression of copper-associated and oxidative stress related proteins in a new variant of copper toxicosis in Doberman pinscher" potx

... citation purposes) Comparative Hepatology Open Access Research Differential expression of copper- associated and oxidative stress related proteins in a new variant of copper toxicosis in Doberman ... hepatocytes, and inflammation with lymphocytes and pigmented (probably copper) macrophages. HE staining. (B) Centrolobular accumulation of copper in...
Ngày tải lên : 13/08/2014, 13:20
  • 13
  • 300
  • 0

Xem thêm