Báo cáo y học: "Association of adenoma and focal nodular hyperplasia: experience of a single French academic center" pptx

Báo cáo y học: "Association of adenoma and focal nodular hyperplasia: experience of a single French academic center" pptx

Báo cáo y học: "Association of adenoma and focal nodular hyperplasia: experience of a single French academic center" pptx

... superficial N (RL) Gross macroscopy diagnosis Adenoma (Hem) Adenoma Adenoma Several small N ? Liver pathology of nodules Adenoma (Hem) Adenoma Adenoma Adenoma - FNH - N? 2 FNH - 1N ? Liver pathology of ... not for citation purposes) Comparative Hepatology Open Access Research Association of adenoma and focal nodular hyperplasia: experience of a single French...
Ngày tải lên : 13/08/2014, 13:20
  • 10
  • 231
  • 0
Báo cáo y học: "Association between expatriation and HIV awareness and knowledge among injecting drug users in Kabul, Afghanistan: A cross-sectional comparison of former refugees to those remaining during conflict" ppsx

Báo cáo y học: "Association between expatriation and HIV awareness and knowledge among injecting drug users in Kabul, Afghanistan: A cross-sectional comparison of former refugees to those remaining during conflict" ppsx

... repatriate to their country of origin. Afghanistan is currently a fragile state, still reeling from the effects of nearly thirty years of civil war and current political instability in several ... risk and poten- tially marginalized group and the accuracy of messages intended for this group. This manuscript reports the asso- ciation between residence outside Afghanistan and...
Ngày tải lên : 13/08/2014, 13:21
  • 8
  • 233
  • 0
Tài liệu Báo cáo Y học: Electrochemical, FT-IR and UV/VIS spectroscopic properties of the caa3 oxidase from T. thermophilus docx

Tài liệu Báo cáo Y học: Electrochemical, FT-IR and UV/VIS spectroscopic properties of the caa3 oxidase from T. thermophilus docx

... incorporated belong to the caa 3 -andba 3 -type cytochrome c oxidases, respectively. The caa 3 -oxidase contains analogous central subunits and catalytic entity to the mitochondrial aa 3 - oxidases, ... two pathways are necessary for the catalytic activity, but different residues may be involved. In an important step for the understanding of the essentials for cytochrome c oxidase activit...
Ngày tải lên : 21/02/2014, 15:20
  • 9
  • 528
  • 0
Báo cáo y học: "Association between antipsychotics and weight gain among psychiatric outpatients in Pakistan: a retrospective cohort study" ppsx

Báo cáo y học: "Association between antipsychotics and weight gain among psychiatric outpatients in Pakistan: a retrospective cohort study" ppsx

... 1 Department of Psychiatry, Aga Khan University, Karachi, Pakistan and 2 Department of Paediatrics & Child Health, Aga Khan University, Karachi, Pakistan Email: Syed Ahmer* - syed.ahmer@aku.edu; ... seen at least once in the psychiatry clinic of AKUH and had been prescribed an antipsychotic medication. All of these had had their weight recorded at baseline. A total of 8...
Ngày tải lên : 08/08/2014, 23:20
  • 4
  • 330
  • 0
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps

Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps

... AGGAAAGCTCATGGGAGGACTAG Reverse primer: ATGGTGAATATCATCATGAAAAAGATTC Probe: CATGCTCATTCTCAACCACATCACCAACA H6PDH Forward primer: CAGGTGTCCTAGTGCACATTGAC Reverse primer: GTAGCCCACTCTCTCGTCCAA Probe: AAGGCACGCCCTCCCAGCG GRα ... AAGGCACGCCCTCCCAGCG GRα Forward primer: GCGATGGTCTCAGAAACCAAAC Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA GRβ Forward primer: AAC TGG C...
Ngày tải lên : 09/08/2014, 08:22
  • 10
  • 438
  • 0
Báo cáo y học: " Combined rotation scarf and Akin osteotomies for hallux valgus: a patient focussed 9 year follow up of 50 patients" pptx

Báo cáo y học: " Combined rotation scarf and Akin osteotomies for hallux valgus: a patient focussed 9 year follow up of 50 patients" pptx

... inflamed and painful. Intraoperatively we always attempted to maintain the length of the first metatarsal and displace the metatarsal head in a plan- tarly direction as part of the rotation scarf ... design of the study, analysed and summarized the data and drafted the manuscript. CO designed the study, reviewed all the participants, collected the data and assisted in data a...
Ngày tải lên : 10/08/2014, 21:24
  • 12
  • 297
  • 0
Báo cáo y học: "Improvement in symptoms and signs in the forefoot of patients with rheumatoid arthritis treated with anti-TNF therapy" ppsx

Báo cáo y học: "Improvement in symptoms and signs in the forefoot of patients with rheumatoid arthritis treated with anti-TNF therapy" ppsx

... higher prevalence of US detectable plantar MTP joint synovial hypertrophy and plantar forefoot bursal hypertrophy was evident than that detectable by clinical examination at both baseline and twelve ... therapy (infliximab, etanercept, adalimumab) were assessed for presence of synovial hypertrophy and synovitis in the 2 nd and 5 th metatarso-phalangeal (MTP) joints and plantar...
Ngày tải lên : 10/08/2014, 21:24
  • 9
  • 315
  • 0
Báo cáo y học: " Acid-base balance and hydration status following consumption of mineral-based alkaline bottled water" ppt

Báo cáo y học: " Acid-base balance and hydration status following consumption of mineral-based alkaline bottled water" ppt

... surrogate markers of whole body acid-base balance [11], would systematically increase as a result of daily consumption of the alkaline AK water. In addition, it was also hypothesized that the same ... in alkaline minerals on acid-base balance in humans. Nut J 2009. 11. Welch AA, Mulligan A, Bingham SA, Khaw K: Urine pH is an indicator of dietary acid-base load, fruit and vegetabl...
Ngày tải lên : 11/08/2014, 23:21
  • 12
  • 480
  • 0
Báo cáo y học: " Mucocele-like tumor and columnar cell hyperplasia of the breast occurring in a morphologic continuum" pptx

Báo cáo y học: " Mucocele-like tumor and columnar cell hyperplasia of the breast occurring in a morphologic continuum" pptx

... intraductal carcinoma, invasive carcinoma, atypical ductal hyperplasia and hyperplasia of the usual type [2-4]. Most invasive carcino- mas that arise in this setting are of the mucinous type ... Morphologic and molecular observations suggest an association, perhaps in a nonobligate precursor role, between flat epithelial atypia and lobular neoplasia, tubular carcinoma and low-gr...
Ngày tải lên : 11/08/2014, 23:21
  • 4
  • 249
  • 0
Báo cáo y học: "Association between occupation and knee and hip replacement due to osteoarthritis: a case-control study" doc

Báo cáo y học: "Association between occupation and knee and hip replacement due to osteoarthritis: a case-control study" doc

... officials and managers Managers and professionals Teachers, doctors Teachers, nurses Professionals Technicians and associate professionals Technicians and clerks Office clerks, ship's ... University of Akureyri, Nordurslod 2, IS-600, Iceland, 4 Faculty of Medicine, University of Iceland, Vatnsmyrarvegi 16, Reykjavík, IS-101, Iceland and 5 Clinical Epidemiology Res...
Ngày tải lên : 12/08/2014, 14:21
  • 9
  • 297
  • 0

Xem thêm